Open Close
General Information
Symbol
Dmel\axed-RD
Species
D. melanogaster
Annotation Symbol
CG8398-RD
FlyBase ID
FBtr0076981
Feature type
Associated gene
Evidence Rank
Length (nt)
2094
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 16 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GTATATACGCTTTTTGGCTCTCGAGCGGAGACGTCGTCGTCGTTGTTGGCTGCCTTTCCCAATTCCGTTTGGCACGAGGC
      GCGCAAAACTCTCGGATCGGATCGCATCGGATCGAAACGGAAATATATACGCGAGTATCGGCGGGGCTATATGGCCAAAA
      TATCTGTATATATGTATCTGATTATTGGCATAAACAAATCGGCGTAAACAGAATTTGCATTAAGTTTGAAGATTTTGACA
      TCGAGGCGGAAGTTCATAGTTATCTCAGCTGAAAATTGGCGAATAAATTTCGAAAATCGAGAGTTGGCCCATCCGACAAA
      TTCATAAACTGGGTTCTCCAGCTCCATCACTGCCTTTCACGACAAGGACAGCCTAGAGCCACGTCCTGGTAACAAATACA
      ACCCGCGTCGCTTCAGCGCCCATCTGGAGGAGCATCTGGTTAAGGAAAAGCGTATCACCAAATTCCCTCTGGTGGGCGCC
      CTGGTCCACAAGGCACTGCGGCGTCGGGAGGAGGCAGAGGACGAGAAGGTGCAGATCACAGGTCCGGAGGACAACCAACA
      CCAACAAAACAACAACAACAACGATTGGGAGCCGAACAGGATGGTGCTACCGTTTGGACTTGGACCCGATGGCCATCACG
      TGGATGCCATTCAGAGTGCTCCGGCGCCCAGTGCGCCCCCCGCCCACATGATGCCACCAGCCTACGCCCGGGGACAAACA
      AACATATACACAGGTGTTCCGATCATCGTGAATCCCTACATAGACTTCATCGTGGTCAACGGGGATGATCGATACATGAT
      CAGATGCGAACGAAAGTCGGTACTCGAGCGGAGCGTGGAGCTGGCCAAGCTTATCCACGCCGGTCCGAACAGCGGTCGCA
      AGAGCGACAATCATTTCCAGATACTCAACGTGGACAAGAACGACTTCGAGCTGATCGTCCGCTACATGGAGAAGCACTTC
      ATTCCCTACCGCGATCACAAGCACCTGCTCAAGATACTGGAGCTATCCGATCGCTTCAACGTTCCAGATCTGATAATCTA
      CTGCATTCGCGAACTTGATCTCAGAATCTCGAGCGCCACGGCACTGGACATCTTCAAAGCGCTGTGGTTCTACCAGGGCA
      TCGCACTGACCAACCAGCACCAAACGGTGATCACCACCCAGGAGACGGGCCAGCAGCTGGCCAGGAAGAAGGCGACCAAG
      GCGAAGGCGGCGGCCAAGCAGCTGGCGGCTGCCAAGGCCTCTCAGTCCACCGAAAACGGAGCGGAGGGCGATGGAGCCCA
      GCAGAACCTCATTCCTAACCCAAATCCCTTTACCACCGAAGATTACGGCGTGGCGCTGCTGCACAACACGCTCCAGCTGA
      TCGATATGCACGCAGAGCTGCAGCTTTCGATGCCGGAGATCAGTGATCTCAGGTTCGAGGAGCTGGAGACGCTGGTCAAG
      AGGGATACCTTGCAGCTCAGGTCGGAGGTCACTCTGTTCGAGTGCCTGGCCACGTGGAGTCTGGCGGAGTGCGCCCGCAA
      GCATATCGATGCCACGCCGGAGAACCGTCGCACTGTCCTCGGTCCACTATGCCTCACACCTCGTTACTTGCGGATGACCG
      CCAGCGAATTCCGGCGATGCTGCGAACGCCTGGAGCTACTGCCACCCACTGAGATATCTCTTATCACCGACGCCCTCGAT
      GGCAAAAAGCTAAAGAACCTCACCGATCAGCAGGCGGAGCTGCTGGAGAAGTTCCGCCAGCCGCGTGCCGAATACGCCCG
      GATGCCCGTCCACCTGAGCGACCGGAGCAGTCCGAAGAACTATCCCAAGAAGATGCGGCTGGCCCACGAGGGTCGGCCCA
      CGGAGGATGGATGCTGGGAGAAGGTGGGAATGAACTGTCTCCGCATCTTCGTCTGCATATTTGACTGATCCGAGCAGTCC
      GATGGGGAGGAGGAGGAGGAGGAGGAGGACGGCGATGACGAGGAGGAAGATGATGGATCCGATGAGGAAAATGGAAATGG
      AAATAGAGCGGGCAGAAATCGATCCAGAGACGACGGAGGATGAGATGATGATCCCACATAGACTTGTTGCATTAAACGAA
      TATTAGCGCTTATG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0076978
      2878
      FBtr0076980
      1850
      FBtr0330184
      1911
      FBtr0474136
      2878
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0076690
      435
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0076687
      537
      FBpp0076689
      435
      FBpp0303217
      435
      FBpp0423135
      582
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG8398-RD
      axed-RD
      Secondary FlyBase IDs
        References (2)