Open Close
General Information
Symbol
Dmel\CG13300-RA
Species
D. melanogaster
Annotation Symbol
CG13300-RA
FlyBase ID
FBtr0077007
Feature type
Associated gene
Evidence Rank
Length (nt)
4303
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 14 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AAACGTTGCCAGCCGAAAAGTCAGCGGGCCGCGGACGACGATATCCCCACAAAAAACCAAACCAGAACCAAAAACAGCTC
        GCAACATTGGCAACATAGCAACCCCCCATCAGCAACATTGGTTTTTTCGTCTTTTGAGTTTCAGTTCAGGGTACCACTAT
        ATGATTTGATATGATACATAAACCCCGATTGTTAAGTGATTTTGTGCGGTGATCAATGTGTGCGATCGGCAGTTTGGCAG
        AATCCCCAAGAATGCCGCGTTAATTGAGCTGTACGTACAGCTATAGTACAAATTTGCATAACCAGTGAGGAGGCATAAAC
        AAATCTGGCCGCCGAGCGGAGGAGCGTCTTGGTTCACTGATTTAATGCCACAAACAGATTGCAGATTGTAGCCCGCAGCC
        GCGCCCCTGCAACTTGCAACTTCTTTGGCTGCAACTTGTGCAGCAGGCAGCAACCAGCTAGCAGCGACCACCTTCACCTC
        CACCTCGAACTCCTTGCTGCATCTTGGACTCGGTTTGGTCTTGGTCAACCTGCTTGCAAGCTTGTTTCTGCGGAAGAGCT
        GCCGCCGGAGCGCCAGACCCGGCAAAAAAAAAAACAAATACAAAAAAAAAACAAAACAAAAAAAAAACAAATCTAAAAAA
        AGTAAGGAAAAACACATACAGAACAACACGGCTGCCGTTGTCGTCGTCTTTGGAATTTTCTTTAAAAACAACGCGCTAAG
        ATTTGCAACGCGGACCCAGGCAAAAAGTGTAAAAGGCAAGCAAATGCATCCGCGGAATAAAAAAATTAGCGCATAGTGAA
        GCGTGTCCCAGTGTGTGTGTGTGTGTCGTCCATTGTACATGAGTGTGTGTTCTAAACGCCGAGTGTGCGAATAAAAAAGC
        TGCCCAACTGAGAGAAAAAAAGTTTGAAAAGTGTCAAGCGAGCGGCTCGGTGGCGGCCAATAACCCAACGACTGGCATGC
        AATTGCAGCCAGGCGACCCCGACGGGTTAATTACCGTTATCCTTGCAACACAGCAACAACTAAAACAACAACGAGCCACA
        CTAAACGGTGCTCAAGTTGTGGATTACGTCTCCGCCGCGTTGTCGCCGTGTGAAAAGGACAACAGGAACACAGCATCTGC
        AACATTGGCCATAAAAAGCGCATTGAGCACACGGCAAAGTCAAGTGAACATTCCAATTGGCAACGTAACGGGCTAATTGG
        CACACACAAACACATCGCTGCACATGAAAACGAGCCAAAAATTGCAAGAAAAGAACCAGAAAACAGGCGAAGCCCGGCGA
        AAATCCCACTCCATTCACCATGATCCAAACGGAGGACTAACGGACAACTGCGATAACTGGCAATAAGCGAGGAGGAGCGT
        CAAAGGATTCCAGCTTTGCCCCTTTATCCGGAAAACTCCCTCAATCCCCCACCCGGAAAACTCAAGGAAAATGCCATCCG
        TAGCAAACAGCAACTACAGCAACGATGCGCGTCTCGGTTACGTTGTAAATCAAGTTGCATCCGTATCTGTGTCCATATCC
        GCATCCGCATCCGCCCTGCCCTCCGTATCCGCATCCGAATTTCCTACTTTCAGTCCACCGCGGATTGCCAGTCTGGTGGC
        CAGCAGCTCCGCGGAGGACTTGAGCAGCTTTGGTGACGTGACGTTCGACATCTTCGATGACGATGACGACTTGTTCGGCT
        CGCCAATGGCCTTTGATGCCAGCGAACAGGGCCTCTGGAACGGACGCTTTGTACCGCCACCGCCCCGCCCGCCTTTCTTC
        GTCGACGAGCCGGTGCTGAGCGACGGCCTGACCACGTGTGATTTGTGCTCCTGGGCGATGCCCACCAAGAGCACATTCAT
        GTTCGAGGGAACGATAGAAAAGGCCACAGAACTGGGCTGGCCACTGACTCTGATCATCGTGTCCGTGTTGTCGGCGCTGC
        TAGGCGCCATCATCATGATTGCCGTGGTGCGCTGCCGGCGCAAAAAGTCCTCCAACAATCGCAACGACACGCACGTGCAA
        TGGTGGTCTCGCAACAAACGCGCCCACGGCAACGGATTGAATGGCGCGGGCGGGGCAAGTGGAGCGGCGGGTGGTGCCGG
        CGGCAATGTGCACCACCACAACGGCAGCAGCAGCAACATAAACAACAACCACCTGAGGAGGAGCAACATCTACACGGCCC
        ACCCGGCGGACAGCATACGAGGTCTGCAACCGCTGCCGGTGGTGCTGCCTCTGCCACTGTCATTGCCCCACCCACCTTCT
        GGTGGAGCCTCGCCAGCGTCGTCGTCGACCACACCGCCTGCTACACAGCAGCAGCAACATCAGCCGTTGCAACAGCAGCA
        GTACTTCCATCCATACCAGCAGCAACAGCATGTGCACCACTCGCATACGCACCACCATCACACGCACCACCATGTGCCGC
        TGTATCCACACGACTGTGACGAGGATGCCGCCTACGAGGAACCGGAGTACCATCAGCCGCAGCAGCTGCACTCGGTCAAC
        AGCAGTAGTTCGTTGTCCTCGATGGGATCGTCATCGCTGCCACAGGAGGCAAGCAATTCCCGAGCCACCCACTGGCCACC
        GGGTGCCACATCAGCCACCATGGTCATAGCCAGCTGAGAAACGGGCCAGGACTGCGCCTGGATTTGGCAGCAGTAATGTG
        AATGGGTCTGTGGACCCGTTTCACTTAAGATGCAGCGCACATGGATGGGTGCAGATCATAAAGGGGATTACACGTAACAA
        TTTTGTGAAGTTTATTTTTGCCAGTTCATCCAGGGACTCCCTAAATGTATCTGTCTGTCGGTCTGCCTGTGTGTCGCCAA
        TTGGGAAAACCGAAACGAATTTAGTGTCACTTCCGTTTCCGTTTCGCAAACTATCGAGTCAGACAGGCGAGAGGGTTGCG
        GTGTGGCGTGGCGTGGCCACAGGACATGCTCTTTACATGCCATGCACGTTTCATCCTTTATTGCCGCTCGGCATTAGAAC
        AGGGATTTCGTCGGATTAAAGCAAATAAAGGGCGTGCTTTCTGTTTGCACCCAACTGGCAACTGCCGATGATGCCACAAG
        TTTAAATCGGAGCAGCCAGCATTGTTACGGGTATATCGAACTGAGCCCCCCAGGGATATATAAGTCATTTCAATGGGTAT
        GCCACAGTTGAGTCTGGTATAGGACCAACATTTGCCACTTGGATTTTGTTTAAATAGACATTTTCAGCTTAAGCCTTGTG
        GGCAAATGTGTGCGAAGCATATTCTGGGAACCTGTCCCGGGCAGACACTGGTCCAGAACTTTGTGGCTTTTTTGACTCCA
        TTCCGCTCTTGTATCGCAATGACGAGAGCAAATGGGCTTTGAAACTGGTAAAAAGTAACGAACGTAAAACAAATAACGAT
        GAGGCGAAAAGTGAAGAGAAAGTGAGAAAAAGAAGTCGCAATATCATCCGCAAAATCATTAATCAAATTATGAGCTCAAG
        CATCTAATAGCATTTGCATTTTTTAATAGCCACTCGTCGTAATAACAAGCCCATGACAAGCATATCAAACATAAGCTCAA
        CAAGCCAACAGCCAACAAAAGTACTTAAAACAATCAAACATTGCAGCAACTTAAATGTAAATGCAAAAGTAAACAAACTC
        GCGCCATTGTATATTAATTGTAAATATTTTTTGCGATCCGCTCCAATTAGCAATTAACAGCAGGAGCGTGCAACAGAAAG
        TTTCTTCAACAACAAAATATGTATTGCATTACTTCAATTCGATAGAGAAAAAAGTACGAAAACATTCCTCTTCAAAGCAA
        ACGCAAAGTTCAAGTTTTCATTTAATAATTATAATTTACGACAACACACAACCAAAGACTAGTCATTTAAGTCACAACGT
        CGATATGTACAAACAAGTTAAACGAGAGATAAAATATGATTAAGCCAGTTAATTAATTCGATTTACGGATGCTTCATTCG
        AATGCATACGATTCGCATTTATTAGTTTTACGAGATGAAAGAACAACTGCAATACTGTATTTTAAATATTTATTCATTAA
        ACGCACTTTTGTCCACTCCCCTTCTATCCCACACAATAACAATAATCGTAATTAGCATTTATAATTAAAAACTCAAACAT
        CAAGTAAATAATAAATAATGAAAACGAAAGACGAGAGCGGAATATGCGCAAAAAATTACTACGAGCAACTCAAAATGTTC
        CAATGTTTAGATTAGCCAACTAATTACATGGAAATGTAAACAAATCAAATACTTCATAGTTTTCATAACAAATTCATTAA
        ATTGTGCAGAAATAATTTAGGCACACAAAATACGAAAAGAAAATAAAAACCAACAAATTAAAC
        
        Other Products of this Gene
        Other Transcripts
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0076715
        388
        Derived from OTHER transcripts
        Comments

        Extended 3' UTR based on RNA-Seq and/or EST data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG13300-RA
        Secondary FlyBase IDs
          References (2)