Open Close
General Information
Symbol
Dmel\Cpr65Au-RA
Species
D. melanogaster
Annotation Symbol
CG18778-RA
FlyBase ID
FBtr0077060
Feature type
Associated gene
Evidence Rank
Length (nt)
453
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 2 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGACTCTGAAAAACTAATTCTTTCCGCAATGCAATCGAATTTCATGTGGCTGGTAGCCTTCCTGGCAATTGGTATCTGTT
        TGGCCTTTCCCGCTGGTGAGGATGCCCAGGCGGAGACCATCAAACTGGAGAGCGAAAACACGGGCGATAAATATTCCTTT
        GCCTATGAGACGAGCAACGGAATCTCACGCACTGAGACCGGTGAGGTGAAACCTGGAGCCGGCGAAGAGGATGGTTCCTT
        GTCTGTCCAGGGATCGACCAGCTGGTCAGCTCCAGATGGCAAAAAATACGAGATTAGTTTCACGGCCGACGAAACTGGCT
        ACCATCCCAAGTTCAGGCTAGTAGCCTAGGAGATACCTGGATGTATAATGATTCCGGATGCGAATAAATAAGTTGACTTT
        ATTTATCCAATGTAAAAGATTCGTAGAATTAGAAAAGTAAATAGAAAAAATGT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0346074
        526
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0076768
        106
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0311912
        106
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG18778-RA
        Cpr65Au-RA
        Secondary FlyBase IDs
          References (2)