Open Close
General Information
Symbol
Dmel\unc-RA
Species
D. melanogaster
Annotation Symbol
CG1501-RA
FlyBase ID
FBtr0077259
Feature type
Associated gene
Evidence Rank
Length (nt)
4454
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 4 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TCACATTTCGCTGTTGGTGGTGAGTGTCTTGCGCTCGTGCTCGTTTTACCTGGAAAGTTCAGTTACTCAAACGCGGCGCA
        TGTAAGCGGCGGTCAGAGGTTCTATCCGAGCATACGCAGACCAACTCTCGATCCCATCCGAGCCTCGAGTTCCTTCAGGA
        CGGCATGAAGGTTCGCCACGTGCCGGCGAGCACGACAACGTTATCGTTCAGGGCGAAGCAGCGGGATGTGGGCGGCATCG
        GCATGCCTTGCGAGCGGGAGCGGAAGCACGAGGCCGCAAAGCGGGAGCGGGAGGAGCAGATTAAGCAGGAGCGGGCCACA
        GCGGCGTCGGCGACACAGCGGGTGCGCCAGCATAATCGAAGGATCAGCACCGACGGCGATCCCGCCAGGCGGAGAATGAC
        GCAGTCCAGGGAGCGACTCCAAGCAACCGGACTGGGCAGACCAGGACCGTGCGGACCATCAAATATAACTAGAGTAACGC
        GGGGATCATCATTGCCCCCGGAGGTTGGAGCACACGGATACCGCACAGGAAGGCCTACCAGAAAGCACGTACCTATTCCT
        CAGGATCAGATTGAGGAGCAGGATGACTCCGATGCCAGGGCGGAACGGCTGAGGCAACAGCTCGAGGAACTGGCCGCGAT
        GTCGGAGCAGGAGTTCGAGGTGAAGTTCCGCCAGTGGCTGGACCAGGAGGGGATTGCCCGGGAGATGCACTCTCACCTGC
        GGGTGGAGCTCATTCACTGCTTCAATAATACGGCACTCGGCCAGCTCTTGAGCAAGGCTGCTGGTGTGCAGATGGCTCAG
        TCCCACGCACTGCTCGTCTCGCCACTGGCGATGGTGCTGCACACTCTGGTGGCGGAGTTTCTGCACTCCCAGAACTGCCA
        CTTCACACTGTCGGTCTTCTGCAGCGAGACGCCGCATCGCAGCAACCTGCCGGACTTCCGGAGTCGGCCGGAGTTCCGAT
        TCCAGACGGAGGAACTGCAGAAGGTCGTGGCCGCCATACTGGGAGAAAAAGAAGCTCTAGCGGATTCGGAATTTGGAAAG
        CTGGCGGAGGCCCACTACGAGGAGGATCTGGCTGGACAAACGCAGTGCTTGCTGATGGCTCTTATGCGAACGCTGGTGGA
        GATCAGGAGGTCCGTGCCTAAGCAGGAGGTGGAACAACCGGTCCCTGTCTCTCTGCAAGACACCGGCTGTCAAACGGAGC
        CCTCTGCCTGCGTGGAAGCTCGTCCCGAGGTGGACACCACTGGTCTGTATCAGACGGAGGAGCACGAGCTGATTCTGGGC
        GCAGATGGCCGAAGTGTCTTTGTGGGCGGTCGTGTCTCGCAATCTCTGCATTCCGTGGAGCAGCAGCTTAATCAGCTGAT
        TAAGAATCTCCGCCATTTGGCCAAGTCGTGTGCTCCGCCCGTTGAGGTGATATCATCGACAAAATTCGAGGATCTCCTAA
        TGAAGGAGCTGCGCGAAAGGGAGCGACTTTTGAAAGCTGGTCAAGCATTTAACCCGGGCGAACCGGTGATCAAAATTGCC
        ACCGGGGACAAGGAAGAGGAGCATGAGGTAACCAGTGGCAGGAACCAGAAAGATGTGGTTCACTCCAACCTGGGACCCAT
        TCAAGTGCCAGCCCTGGATGTGACCATTCCTCAGCTGCCCCGTCTCCACAGTGAACAACTGGCCAGCCTGGCCGTGATCC
        GCCAGTCCCTCGAAAAGGTGCAGAAAAAGAGCCGGCAGCCGCAGGGCCGGATGTACGTCTCCATGGAGCGAATGGAGACC
        CTGATGGGGGATGTGTGCGGCTGTGTCCAACTACTTAGCAACGTTCTCAATCTCTCCATGGAGCAGGAGCACTCTGTGGG
        CATGCACAAGGGCTTCAAATGGGGCTACCGCGAGGGTTTTGCCCACGGCCACTTCATGGGCCTGCAGGAGGGTCAGAAAC
        TGGAGCAGTTGGAACAGAAGAAGTGGCAAAAGGAAAGGCCACTGCCCGAGAAGCGGGAAAGCTCCGTGCAAACGGAGAGC
        ACGATACCCACGGCGAGTATAGCCACCCAAACATCGAGAAAGTCAGCTCACAATGAAAGTGTCATCACCCAAACGGAGCA
        AAAGCAGCTAAAGGACGCTGGGAATCAGGCTAGTTGCGAGCCGCCAACCTTCCAAAAGTCCTACGAACAGTGGATCCACG
        AGATGCTGCACAGCTCCAGTGGCCAAGTGTTCCTCGAACGGGTGGAGCTCTCCTTGAACAAGGCGCTGGAGCTGCAAAAG
        GTGCGGCTAAATGAACTCTTCCAGGTGAAGTTGCGACACCAGGCCGAGATGCTTCGTCTAAGCAAGCGGCAGAACTCCTG
        GCGGACCCTGTGCAAGCGTGTGGAGCGGGACTCGCAATCGTCAGCGGAGGCGCGCGACCTCGTGCAGCAGATCTTCCGGC
        TGCTGGAGCACTACGAGGCACACCATCAGCAGCTGGCGGAGAAGATCCAACAGACGGAGCTTGCAGCGGAGCAGGCGGCT
        CGCATCATGCCCATGTGGGCGGATGGAGCTGCTGTGGGCTCCGCTTCTGTCAACTGGAACACGGCGATGTCTACCACGCT
        CATTTCCAGTGGGATCTGCACTCCGCCTCCGGCTCAGCCTGCCGCTGATGGTGCGCTGAATGTTGGTAAGACCCATGTGG
        AACAGCACACGTATCCTGACCTGGGATATCCCTATCAATTGTTGGCATTAGCTCCGCCAGGTGGAGTTCCAGTTGCAGGC
        ACCTTCGTGCCAGTGACTCACCTTCCTGCCCACTTGCTTGGGGCTTCTGAACACCCTGTTCCTCTGGTCCCAGTTGCAAG
        GATCTACAGTGATCCTATGAAAACGTCAAGACGACTGCTTTCTCCGAGTAGCGTTCCTGCAGACAATGACAGTGCTCATC
        GCGCAGCCGGCGAAACCAATGCTTTCACATTCCAAGGAGGCCCCGTATCTGGGGATCTGCATCCAACTGAAAATAGAAAC
        CAAGCTCCTGCTACTCAAGGACAACAGTTTCCTGTTCCTTTACCTGTTCCTGCTCCTCGGGGCCCTTCACCAAGTGTACA
        GAGTGTTTTGCCCTCCACTGCATCACCGGCACTTCCGCCGCCCGATGAAACGGTACCTCAACCAGGACCTTCCCAATCTT
        CTATTCCTTTGAAACCGTCAATGCACTCGGTGGCCACCAACACGATAACTCCAGTGCCTCCAAAGGCGACGCCTCTCAAA
        CCGGTAAATAGCAAAGTTTCAGAAGGTCCGAGCTTTGAGGAGGCTCTACTAAGTGCCAAAAGCCGAATGCTGCAGTTGGA
        ACAGGAGAGCGACCTATTGGAACAAAGTTTCCTCAGCTACCTGGAGAAAACCAAGTCGAAGACATCCCCCCACAAGTCAT
        CGGAGGATGCCGCAAGGGCCCGGAGAATCCGCTCCAGCTGCCTGCGGGAACGAGAGCAGGTGCATCGCACTATGGACGGT
        TTCCGGGATTGGCATCGACGCGTTCGCAAGGAGGACGCAGCTAGTGTGGCTCAACTGGAGGAGCTGCGCAACCAGCGACT
        TATACCCGATCCCATCTTGGACTCAAAGGGGTCGTCACCGCTGTGGCTATCGGAACTGGAGGAGGGTCACGAACAGGACA
        GCTATCCCTTTACGAATGCCATCACCGAAGCTAGGAACAAGGTGCTGGACAAGATAATGCCAGTCAGAAAGGAGGAGAAG
        AAGGAGAAGCAAAACGTTAAGAAGAATTGGCTAGCAGATTTGCCATTTCAGATTCCTGAGGCATCTCCGAAACAGGATCG
        CCATCTGACCAATGTTAAGCCCGCTGTAACGCGAAGCAGCAGCAATGGTGAGATGAACGTGCTCCTCCAACGGGCCAAAG
        ATGCCCTCGGCCTGAGAACACCAAACCCACTTCTGGATAGCAGCAGCAGCAGTTCCAGTATGGAGCTGCCCTCCATGGGT
        GCCGGCAGATCGCCCAGTACAAAGTTCCAGCAATCCATGGCCAGGATGCAGATGCTCTTTGGCGGCGCAGAGGCCGTAAA
        ACCTACAATGCCCGCCAAAACAGGAAGACCTGTGAGTGCACCCACCGCAGCATCGGAACCGGGGTTGTGTGCACATTTGG
        TGCTCCCGAAACGCCCCCACACGGCTCCCACTCTTCACACAATCAACGAAAATGAACCAGCTGTTCATCATTTGGATGTC
        TCCACTTCCAGTTCTTCGCAAAGCACTTTGCCCGGGAGATCGTCGGGCGAAGCTTTCGAGGATTTGGTCATGAGCGCCGT
        GGCGGATGGAGCCCGGCGGCGGAATGCGGAATCTAGCACGGAGGTTTCGTACAGCCAGGCGTTCTGGAAACGCATAAACC
        TGTAAAAAAAATCTAGAATAGGTGCTTAATATGTTCAAACTGATTAAGTATATATCTATTTAGGTTCCAAAACTCTCTTT
        ATAGAGCAACAAAATAGTAATAATACAATTAATAAAACTCATTGTTTTTTGGCC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0340040
        4775
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0099828
        1386
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0309047
        1386
        Comments

        Transcript model confirmed by FBrf0179123 and EST LP08350

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG1501-RA
        Secondary FlyBase IDs
          References (2)