Open Close
General Information
Symbol
Dmel\bowl-RC
Species
D. melanogaster
Annotation Symbol
CG10021-RC
FlyBase ID
FBtr0077491
Feature type
Associated gene
Evidence Rank
Length (nt)
3424
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 75 )
Sequence
GTGGCTCAGTCTTCGAGAGTTGATCGTGGCCAACGCACCTGCGCGCGGATCGCTGGTAATAGCTGTTGGAAAAGTGAACT
GCATTAATCGTATTAACAGAAGTCTTCAAACAAATACAACAAGAAAAAACAACATACAATTCAAGTGCCACTTAAATGAT
ATAAATTACTACTTTAAAAACCAAAAACAATGCCAAGCATTTCAAAGCTTACAAACTGACAAAAAACCAGCAAAATCATA
TTGAAACAACTACTTGGATACTTTAGGACGCAAAGATAAAGCCCAAAGAGCCTGGGGCTTTCTTCTGTTTAACCCACAGT
TCCAACGGAATGTGAAGAGCCCCTCCAATATAATGCCCACGGAAAGCTCATCCAGCGAGATCTCCGGCGGAGGAGGCGGT
GCGATACCCATGCTGCGACCTTCCCGGATGGATCAGTTCATGAACTCGATGGCGGCGGCAGCGGCGGCGGTGGGTGGTGG
CGGTCTTCCTGGTGCGGCGGATAGGAACGGCGGATCCGGAGGATCGGATGGTGGCTCCCAGAATGGCAACGGCGATTCGC
GCAACTCATCGGCCAGCCGGATCTCAGCGTATGAAACACAGCTGGCCTATCAGCAGCATTTGGCCGGACTGCATGGTCCG
CCGCCACCGCCACCACCATCGCATCATCGCGAGATCTCTGCCTTTGTGCCGGTTCTGCCCACCGGAAAGGTGCGCCCGGG
TAGTAATTCCAATTACGAAATCATTGCCATGATGGCGGACAAGCGAAAGGAGTTGGCCCTAAGGGAGGCGGCTGCGGCGG
CGGCAATGTTAGGACGAGGTCCTGGAGGACCCGGCGGTCCTGGTGTGCCACCGCCTGGAGTGTTGTACGGACCAGCTGGC
GTGCCACCTCCGCCATATCTCACCGGACCGGGTCCATCGCCCACGGGAGCCGGAAGTTTTCCATTTCCACCAGGAGCCGC
CGCCGCAGCTCTATTTCCACCTGGCCTGGGTCCTGGAATGCATGCCGGACTCGATAGGCGCCTGCTACGTGCTCCTGGTC
GGGCATCGCGGCCTAAAAAACAGTTCATCTGCAAGTTCTGCAATCGACAATTCACCAAGTCGTACAATCTGCTCATCCAC
GAGAGGACACACACGGACGAGCGGCCCTATTCCTGTGATATCTGCGGCAAGGCGTTCCGGCGACAGGATCACCTGAGGGA
TCACAGGTATATTCACTCCAAGGAGAAACCCTTCAAATGCACGGAATGCGGCAAGGGATTCTGCCAATCGAGAACCTTGG
CTGTCCACAAGATCCTGCACATGGAGGAATCACCCCACAAGTGCCCCGTCTGCAGTCGATCATTCAATCAGCGCTCCAAC
CTGAAGACCCATCTGCTCACCCACACGGATCACAAGCCCTACGAGTGCTCTTCATGCGGCAAAGTTTTCCGCCGTAACTG
CGATCTACGACGCCATGCCTTGACCCATGCAGTGGGTGAGGTCAACTCCGGGGACTATGTGGATGTGGGCGAAGAGGATG
AGGCCAGAAATTTAAGTGGCGACGAGGAGGATTCGTTGCTGGAAGTGGACTCGCCTCGCCAGTCGCCAGTTCACAATTTG
GGCGAGTCTGGAGGATCGGGTGAGAAATCTGAGTCCGAAAGAATGAGACTCAAGCGCAAGGCAGCCATCGATCATGAGGA
AAGCGAAGAGGAGTTCGATGACTTCGACGAGGAAGAGGAACTGCAGGATCTGCCAAGAGTACACGATTTGCCCAGGGAAG
AGGACGACGACTTTGATCCCGAGGACGAGGAGCAGGCAGAAGTGGCACTAGTGGCGCGTTTCCAGGCGAGTAAGGCTGCC
GCCACATCGCAATCATCGTCGTCAGTGGGCACCAAGCCGGAACGCCAGGGAGTCACCCACTGTCATCATGAGGGTGGTGA
AACCTACACAATGCGGCCACATGGCGAGAAACATCAGGAGGAACCCGGGAACTCTGGCATTGCCAGCCTACCCGTTCCAC
CTTCCTTTGTGCGATATTCTGTACCACCTGGGGCAGCTGGACCGCCGCCTGCACCACCTGGAGCTCCTCCGCCAACCCAC
CAGCACCCAGGACATCCACACTTACTCCCACCCAACGGGGATCCCTATTTGCCCATTCTGCACGTTCGACGCGACTTGCA
CCACAAGAGCTTGAACCTTTCGAAGGCTGGTGTTCCACCGCCACCACATACACCACCCACTATAATAACCCAGCCGGAGT
CGGGTAAACCACCCAATCAACCTTTGCATTCACCGCATGAAGCTATGCCCAGCTTCCTGGGATCGATACCCATGCGAAAG
AGGATTCTTCCGGCACCGACCTTGGACTTGATGGATCCGCACCACCATCCTGGATTGGGTCAAAGGACCTTTGTGGATAG
TCCCAGCATATATGCTTTGAATATGTCGCGACATCCCCCCAGACAGCTTCTGGGAAAACCACCGAGTACGGAAACAAGTG
GAGCCACCACCGAAAAGGGACCACCAGTGGCAGCACCGCCCATAGCACCACCGCCTGCACCACCGAGAAGAACAGGGTTC
AGCATTGAGGACATAATGAGGCGTTAGAAGTAAACCGAGAAAGAACTAGAAAACAATCCATTAATGGAGGTAAAATCGGA
ATAGAAAAACAACACAATTTGGAAAACTATTTATCAAAGCTCTTACGAATTTGAAATATCAAAAAGTAGTAGTATTCCTA
ATAAATATATATCTCGGTTGTTTTTTCTGGTATTTCATTTAGAAGGTCTTATGAACAGTTGAATATCATAATGACAAACA
GTTATTGTTCCCAATGGTTAAACGAGGATTTATCGTTTTAGACCCACAAGTACATTAAAATAAATTTAGATCTACAATTT
AATACTTTTTAGTACAATGTCTAGGCAAGGCAATAGACCTAAACTAAGTAATAAAATCAGTTAAGCGATAATTGTAAGCG
AAACAAACTCCGTTGTTGCATTTTATAGAGCTCTTATGCGTTAGGATTTTAGCTTAAATCTACCGATTTAAATGTTTAAG
CCTTTAGTACGAGAGTCTATCGATTAGTTTTTAATGTGTGGCCCAACACTAAGTGTTGCTGTTTGCTGAGTGAATTCCAA
TTTTTTATTTATGTTTCCTTATCCGGTAAGCTAATCTTAATGAGTAAACAAAATCGTTAATCGATTTTGCTGTAGGGAAA
AAAATGGTTGAAAGTAAAAGTTAGTGTAAAGCAGAGCATAAACAAAAATCCAACTACAAGCAACATTCCAGTAGAACCTT
ATGTAATTAGGCTTAAATTTTAAGAGTTTTGCAGTAGTTAATATAAGCAACCCATAGAATTCCATGGTCTTCCTTCAATT
TTAAATGATTTTATTCAAACCATAGCGAGTTAGTTGATTTCAAATAAAGTATGCATTAATAATG
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0077493
3485
FBtr0077490
3513
FBtr0077492
3630
FBtr0307027
3507
FBtr0307028
3394
FBtr0307029
3435
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0077180
744
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0077182
744
FBpp0077179
744
FBpp0077181
744
FBpp0297870
744
FBpp0297871
744
FBpp0297872
744
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (3)
Reported As
Symbol Synonym
CG10021-RC
bowl-RA
Secondary FlyBase IDs
    References (2)