Open Close
General Information
Symbol
Dmel\bowl-RD
Species
D. melanogaster
Annotation Symbol
CG10021-RD
FlyBase ID
FBtr0077492
Feature type
Associated gene
Evidence Rank
Length (nt)
3630
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 23 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ACATTTCAGCTGCCGTGTATCTCTCGTTCTCGTTCGGTTTTCAGTTCGTTGAGGTTGAGGTTTCGGTTCGGGTTTTTCTT
        CGTTCGGTTTTCATATCTGTGAGATACAAATACATCGTGTGTTTGTGCGCGAGTTGTACGTGGATTTTGGAAGGAAAAAA
        ACTACGTGGTTTGTGGTAGCTGACTGCCGTTGATGCTGCTGCTGCTCCCGTAACCGCCCCCCTGCCGCCCCCTCAGCCCC
        ACCCCCTGGGGCGATCGTGCCGTGATTTGAATCTCAAAATTGTCCCTTAGTAATCGTATTAACAGAAGTCTTCAAACAAA
        TACAACAAGAAAAAACAACATACAATTCAAGTGCCACTTAAATGATATAAATTACTACTTTAAAAACCAAAAACAATGCC
        AAGCATTTCAAAGCTTACAAACTGACAAAAAACCAGCAAAATCATATTGAAACAACTACTTGGATACTTTAGGACGCAAA
        GATAAAGCCCAAAGAGCCTGGGGCTTTCTTCTGTTTAACCCACAGTTCCAACGGAATGTGAAGAGCCCCTCCAATATAAT
        GCCCACGGAAAGCTCATCCAGCGAGATCTCCGGCGGAGGAGGCGGTGCGATACCCATGCTGCGACCTTCCCGGATGGATC
        AGTTCATGAACTCGATGGCGGCGGCAGCGGCGGCGGTGGGTGGTGGCGGTCTTCCTGGTGCGGCGGATAGGAACGGCGGA
        TCCGGAGGATCGGATGGTGGCTCCCAGAATGGCAACGGCGATTCGCGCAACTCATCGGCCAGCCGGATCTCAGCGTATGA
        AACACAGCTGGCCTATCAGCAGCATTTGGCCGGACTGCATGGTCCGCCGCCACCGCCACCACCATCGCATCATCGCGAGA
        TCTCTGCCTTTGTGCCGGTTCTGCCCACCGGAAAGGTGCGCCCGGGTAGTAATTCCAATTACGAAATCATTGCCATGATG
        GCGGACAAGCGAAAGGAGTTGGCCCTAAGGGAGGCGGCTGCGGCGGCGGCAATGTTAGGACGAGGTCCTGGAGGACCCGG
        CGGTCCTGGTGTGCCACCGCCTGGAGTGTTGTACGGACCAGCTGGCGTGCCACCTCCGCCATATCTCACCGGACCGGGTC
        CATCGCCCACGGGAGCCGGAAGTTTTCCATTTCCACCAGGAGCCGCCGCCGCAGCTCTATTTCCACCTGGCCTGGGTCCT
        GGAATGCATGCCGGACTCGATAGGCGCCTGCTACGTGCTCCTGGTCGGGCATCGCGGCCTAAAAAACAGTTCATCTGCAA
        GTTCTGCAATCGACAATTCACCAAGTCGTACAATCTGCTCATCCACGAGAGGACACACACGGACGAGCGGCCCTATTCCT
        GTGATATCTGCGGCAAGGCGTTCCGGCGACAGGATCACCTGAGGGATCACAGGTATATTCACTCCAAGGAGAAACCCTTC
        AAATGCACGGAATGCGGCAAGGGATTCTGCCAATCGAGAACCTTGGCTGTCCACAAGATCCTGCACATGGAGGAATCACC
        CCACAAGTGCCCCGTCTGCAGTCGATCATTCAATCAGCGCTCCAACCTGAAGACCCATCTGCTCACCCACACGGATCACA
        AGCCCTACGAGTGCTCTTCATGCGGCAAAGTTTTCCGCCGTAACTGCGATCTACGACGCCATGCCTTGACCCATGCAGTG
        GGTGAGGTCAACTCCGGGGACTATGTGGATGTGGGCGAAGAGGATGAGGCCAGAAATTTAAGTGGCGACGAGGAGGATTC
        GTTGCTGGAAGTGGACTCGCCTCGCCAGTCGCCAGTTCACAATTTGGGCGAGTCTGGAGGATCGGGTGAGAAATCTGAGT
        CCGAAAGAATGAGACTCAAGCGCAAGGCAGCCATCGATCATGAGGAAAGCGAAGAGGAGTTCGATGACTTCGACGAGGAA
        GAGGAACTGCAGGATCTGCCAAGAGTACACGATTTGCCCAGGGAAGAGGACGACGACTTTGATCCCGAGGACGAGGAGCA
        GGCAGAAGTGGCACTAGTGGCGCGTTTCCAGGCGAGTAAGGCTGCCGCCACATCGCAATCATCGTCGTCAGTGGGCACCA
        AGCCGGAACGCCAGGGAGTCACCCACTGTCATCATGAGGGTGGTGAAACCTACACAATGCGGCCACATGGCGAGAAACAT
        CAGGAGGAACCCGGGAACTCTGGCATTGCCAGCCTACCCGTTCCACCTTCCTTTGTGCGATATTCTGTACCACCTGGGGC
        AGCTGGACCGCCGCCTGCACCACCTGGAGCTCCTCCGCCAACCCACCAGCACCCAGGACATCCACACTTACTCCCACCCA
        ACGGGGATCCCTATTTGCCCATTCTGCACGTTCGACGCGACTTGCACCACAAGAGCTTGAACCTTTCGAAGGCTGGTGTT
        CCACCGCCACCACATACACCACCCACTATAATAACCCAGCCGGAGTCGGGTAAACCACCCAATCAACCTTTGCATTCACC
        GCATGAAGCTATGCCCAGCTTCCTGGGATCGATACCCATGCGAAAGAGGATTCTTCCGGCACCGACCTTGGACTTGATGG
        ATCCGCACCACCATCCTGGATTGGGTCAAAGGACCTTTGTGGATAGTCCCAGCATATATGCTTTGAATATGTCGCGACAT
        CCCCCCAGACAGCTTCTGGGAAAACCACCGAGTACGGAAACAAGTGGAGCCACCACCGAAAAGGGACCACCAGTGGCAGC
        ACCGCCCATAGCACCACCGCCTGCACCACCGAGAAGAACAGGGTTCAGCATTGAGGACATAATGAGGCGTTAGAAGTAAA
        CCGAGAAAGAACTAGAAAACAATCCATTAATGGAGGTAAAATCGGAATAGAAAAACAACACAATTTGGAAAACTATTTAT
        CAAAGCTCTTACGAATTTGAAATATCAAAAAGTAGTAGTATTCCTAATAAATATATATCTCGGTTGTTTTTTCTGGTATT
        TCATTTAGAAGGTCTTATGAACAGTTGAATATCATAATGACAAACAGTTATTGTTCCCAATGGTTAAACGAGGATTTATC
        GTTTTAGACCCACAAGTACATTAAAATAAATTTAGATCTACAATTTAATACTTTTTAGTACAATGTCTAGGCAAGGCAAT
        AGACCTAAACTAAGTAATAAAATCAGTTAAGCGATAATTGTAAGCGAAACAAACTCCGTTGTTGCATTTTATAGAGCTCT
        TATGCGTTAGGATTTTAGCTTAAATCTACCGATTTAAATGTTTAAGCCTTTAGTACGAGAGTCTATCGATTAGTTTTTAA
        TGTGTGGCCCAACACTAAGTGTTGCTGTTTGCTGAGTGAATTCCAATTTTTTATTTATGTTTCCTTATCCGGTAAGCTAA
        TCTTAATGAGTAAACAAAATCGTTAATCGATTTTGCTGTAGGGAAAAAAATGGTTGAAAGTAAAAGTTAGTGTAAAGCAG
        AGCATAAACAAAAATCCAACTACAAGCAACATTCCAGTAGAACCTTATGTAATTAGGCTTAAATTTTAAGAGTTTTGCAG
        TAGTTAATATAAGCAACCCATAGAATTCCATGGTCTTCCTTCAATTTTAAATGATTTTATTCAAACCATAGCGAGTTAGT
        TGATTTCAAATAAAGTATGCATTAATAATG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0077493
        3485
        FBtr0077490
        3513
        FBtr0077491
        3424
        FBtr0307027
        3507
        FBtr0307028
        3394
        FBtr0307029
        3435
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0077181
        744
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0077182
        744
        FBpp0077179
        744
        FBpp0077180
        744
        FBpp0297870
        744
        FBpp0297871
        744
        FBpp0297872
        744
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (3)
        Reported As
        Symbol Synonym
        CG10021-RD
        bowl-RB
        Secondary FlyBase IDs
          References (2)