Open Close
General Information
Symbol
Dmel\CG18131-RC
Species
D. melanogaster
Annotation Symbol
CG18131-RC
FlyBase ID
FBtr0077936
Feature type
Associated gene
Evidence Rank
Length (nt)
1454
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 3 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GCCAGTAGGTGACGTTCGTTGTGGTGCGGGCCGCACGATGTCCGAGAATGCCAGCAACAAGAGCCAGCTTATATCTAATG
        ACCTAGACGAAGATGAGACTGCGGCCGCCACTCAAGTCAACATATCCAGTCAGCTGGCCAAGAAAATATGGGGCGTAACA
        TCCAACGACATTTCCCTGGGTCTCGTGGAGGCGTCTGAGGAAGCTGTGCCCAATTTTCCAAGTGGATGCGAATCAGGAAC
        GGGGTGTGAAATGGGATCTGCCAGCAAGCCAGCGGCCAGCGAAAGTGTCAGCAAGCCAGCGGCCGTCGACAGTGCCAGCA
        TTTACGTAACCGAGGTGGAGCGCGTTCTCTACGGAGATACCATCGGTTACCCGGAGAACGGCACTCATAACTACTTCAAG
        GCCGCCGAAAACTACTCCCTGTTCGGGGAGAGCTTCCTTGACTTTCCCAAGGACATGGCCAGCTGCCTTGCGGGCCTGAA
        ACCGATGAGCGGCTTTCAGCAACAACAAAGACAGATCCCTCAGCATCAGCAGCAACATCAGCAGCAGCAACATCATCAGC
        AGCAACATCATCAGCAGCAACATCATCAGCATCAACAGCAGAAACATCAACAGCAACAGCAGCAACATCAACAGCAGCAG
        CCACATCGTCAACTTGGCACCGAAAGCCACAATCGCAACTCGGTTAAAAATTTCAATGAGATACCATTTCCCCAGTTTTA
        CCATCAGATGCGACACCAAGCGCCGCCACAGCCGCAGTTGAATGCGCCACGCAGCCACCATCATATCCACATGCCACAAA
        AGCAGCAGCAGGTGGCACCACAGCCACCACCGCAACAGCAGCAGCAGCAGCAGCAGCAACAGCAGTATCAGCAGCAGCTT
        CACCGTCCAAGTGTCGGGGATCTAGCTGCATTGTCCAACGCCAATCCCAAGGACTTTGCTCTGCTGTATCAGCAATTGAT
        CGCTCGAAATCTGCGTCAAGCTTCGCAGCACAACCAGCAACACTCGCAACAGGCTGCCCCGCAACAACCTCAGGCTCCTA
        ACAATGCTGCTGCTGCTGCAGCCATGATCTACAAGAATCTGGAGTTTCAGCAACAAGTGCAGCTGCGACAATTGCAACAG
        CTGCATCAGCAGCAGCAGCAGCAGCAGCAACAGCCTCGCATGCCACGTGGCATTTATGGGGGCAACGGTGGTCAGCAAAC
        CGCACAAAATGGAAAGGAACATCAAGTTGGAACCCACAAGTAACACCAAATAGCTAAGAGGTCAGATTTCCTAATGTCCA
        ATCGATCGGAATTAACGCCCATTAACAATTCACATTTATTTGTCCAACTTTTACAATGTAATTGAATTTTTTTCTGTCAT
        TGCCATTTATACAATTGGTAATATTTGTTTACCAAATTATAGTCCGAATATTTTTTTAAATAAATTCACTTATCACGCAA
        GGTGTGATAGTCAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0077938
        1511
        FBtr0077937
        1565
        FBtr0077939
        1628
        FBtr0334821
        1627
        FBtr0334822
        1744
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0077601
        401
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0077603
        401
        FBpp0077602
        440
        FBpp0077604
        440
        FBpp0306855
        401
        FBpp0306856
        440
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG18131-RC
        Secondary FlyBase IDs
          References (2)