Open Close
General Information
Symbol
Dmel\dock-RB
Species
D. melanogaster
Annotation Symbol
CG3727-RB
FlyBase ID
FBtr0078014
Feature type
Associated gene
Evidence Rank
Length (nt)
3618
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 45 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CTATCGCCTTCCGCACATCGAAATCGGATGGGCGACGTGAAAGAAACGGCTCCGGCAAAATCATTAAAATTTAATTAGTT
          AACCGCAAGAGAGCGCTGCAAAATTGTGCAAACAATTTGCCACTTAACGCAGTTAACGTGTGCGGTAATCAGAAGCGTGG
          AAAAGCGTTTATTTGTCAGGATTTGTGTGTTTTTCAATCGCGGCAGCAGCATATGTACACACACACAGGCTCACCCCCGC
          CCCACTCACACACACACACTCACGCCTAGGTGTATTATAATTAAAGTTGTGTTTTAAGTGTGTGTAAAGTGCAATAGCCC
          AGTGGAAAGTGGAAGTGATATAGAGTGCGTTCCAGGAGTTCCAGGAGCAGTGTCTTATCCCATGTCTTCCACTCCCAAAT
          CCTGAGGATTGCCAAGGGTTAAGACCGAGAAATACGGACTCCGACTTTCCGGATAAGGATACGGATACGGATAAGGAGTG
          CCAGGATAAGGAGATCCAGGAGGAATATAGGAGTTGCCAGTCCAACCGCTTCGTCTCCGTCCACCAACACTGAGCCACCG
          CCTCTTGCCTCCAGGAGCATCACCAGGAGCATCAGGGCAGTCCCAGCTGGAGGAGCAGGAATCCCCCCGCGGCGGAGGAG
          CAGCCAGTCTGGAATGTTGGAACACCCCCAGCGGTTTGTGCGCAACATCCCCGACTCCTCAGCCAGTTCGCAGCAGTATC
          CGCAGCAGCAGCAGCATCCGCCACAGCTGCCGCAGCACCAGAATCTGAATCTCAACCAGAATCAGAACCTGAACCAGAAT
          CAGATCTACCAGTACCGTCCCCAGGTGCCCGTGCCCGTTCCCGGCTCACCTGCCCATCACCAGCGGCACTCTTCGCTCTC
          CCAGCAACAGCAGTTGCACCACCACCGCACCCTGTCCACCGCCTCCTCCTGCAGCGCCCAGCACAAAAGTGTGACCTTCG
          GCCAGCCAGCGCTCGACTGCGGCGGCAACGGCAGCGGAAGCGCCAACGGAAGCGGTAGCGGCAACTCCTCCAGTGGCAGT
          GCCGCCGGCAACGCTGGAACCCAATCAATGGCGGGCAACATGAAGCACGGCAAATCTCAGGACGACGTCTGCTACGTGGT
          AGCCAAGTACGACTATGCGGCGCAGGGTGCCCAGGAGCTGGATCTGCGCAAGAACGAGCGCTACCTGCTGCTGGACGACT
          CCAAGCACTGGTGGCGCGTCCAGAACAGTCGCAACCAGTCCGGCTACGTGCCAAGCAACTATGTGAAGAAGGAGAAGCCC
          TCGCTCTTCGACAGCATTAAGAAGAAGGTGAAAAAGGGCTCCGGATCGAAGACACTGCCTAATTGTTCGCCTTCGCGACA
          GGTCGAGAGTCCAACCATGTCGCGCCGACTTCCCCCAGATCCCGCAGAGGCCATCGGAACGGCTGTGGTCAAGTATAACT
          ATCAGGCCCAGCAGCCCGATGAACTTTCGCTGACCAAGGGCACACGAATCCTCATCCTGGAGAAGTCCAACGATGGATGG
          TGGCGTGGACAGAGCGGCAATTCCGTCGGCTGGTTCCCCAGCAACTACACAACGGAGGATTGTGATAACGACGGCGAGAT
          CCACACCTACGCAATGGCCGAGAACGTGCTTGATATTGTGGTCGCGCTGTACAGCTTCACGTCAAACAACGACCAGGAGC
          TCTCGTTCGAGAAGGGCGATCGCTTGGAGATCGTGGATCGGCCCGCCTCCGATCCGGACTGGTACAAAGCTCGCAACAAT
          CAGGGCCAAGTCGGTTTAGTTCCACGCAATTATCTCCAAGAGTTGAACGACTACCTGGCCACGCCCTATCGTAATGCGAG
          TGCCAGTGCAGGAAACGGAAATGGAGGAGGAAGTAATGGCGGCGCAGGTGGTGGCGGAGGAAACGACTCCATGGAGCGGC
          GCAATGAGGGTAATAAGCCGGCGGCGCAATCTTCCGGCCAGCCAATCGAGCGGCCAAATCTGGCGGGCAAGTCGTGGTAT
          TATGGAGCCATCACCCGCAGCCAGTGCGACACGGTGCTCAACGGCCACGGGCACGATGGCGACTTCCTCATCAGAGACAG
          TGAGACTAACATGGGAGACTATTCGGTTTCGTTAAAGGCCCCAGGGCGCAACAAGCACTTCCGCGTGCACGTGGAGCAGA
          ACATGTACTGCATTGGGCAGAGGAAGTTCCACTCGCTGGACCAACTGGTCGATCACTACCAAAGAGCGCCCATCTACACG
          AATAAGCAGGGCGAAAAGCTGTATCTGGTGCGATCGCTGCCGAAGGCCAATGGCACGTAAGCAGGTCCAGGACTGGAGCA
          GAGAAATCTCAGCATTCATATTACCCGTATTCAACAACACACATATGCAACACAAAGATATACCAAGGCTAACTTGTAGG
          CAGCTCAGCTCAGCGCGACGTGTAGTTCAATATAGTTCGGTTTGGATATTTAATTATGGACTCAGTTTTGGATTAGATCA
          GACCAGCGTGTGTATATAGATCGGTTGGTTCAACGCGACCCGTACGTATAGCCACGGCCAAAGGACCTTTTTGTACTTTT
          ATATAATTGAATTAACTAAATTAACGCTTAATTACCGCATTGGCTATGTTAACGAGGAACGAGAAACTCAAGAACTCATC
          ATTGCATTCGATTCAATTTGAGCAAATCTAGATGTCAACATGCAATACATTACATATTTACATACCGTACATGTGCACAT
          ATTATACTATATTCTAAAGCAAAGTTGTAGCTTCCCTATGTACACAGAGAAAAGAGGCCGCTTTTAATCAGAACACTCGA
          ACATGTAATATGAGATATATGATATGATATGATATGATATGATGTCTATTATCCACGCGTTAACCATAAGCAAAATGTGT
          ACGATCGTAACCAATTCGCATAGATATCGATTTCGTGTATGTACATACATAGGTGAGACATCCTGATCCTGGATCCAGGC
          CACTCAACCCACAAAGCCAGAGTGAGGAAAACGCTCCTACAGTCATTTTTGTTATTTATCCATTTAATTATCGACTACGA
          CATAACCACGCAAAACAAAACAAATACACTTGATATCTCCGCGCGGAGTCTGCTCCCCGCATTATTATAAACATAATCTA
          ATCGTTTGCTGGCGTGGAGGAGGGCGGCGACTTATACGCGTATAAGCCATACTGTACAGTTGATGCAATGCTAACCTAGG
          CACTCTTTCATCTCTAGATATACGTGTACTCTTATTTACGATACGATTACGATTACGAGTAGAACGCAGCGATTCCAGCT
          TTAACTTTTGTTTTGAATTATTGCTATTATTTGTTTTTCTAAGTTTACGGTTCATTATTACAATTGCGATTATTATTTTG
          TTTTTATTTAGCTCTAGGAAAGTAATTAGCGAAGGAACGGAACGATAGAAAGGAGTGGCTGCCAGTTAAATGACTTTCGA
          CTTTCTTTCCCATGCGAATTTTTAAATTATAAATCTACATTATACGACTACGTAACATAAAACTTAAATAATTTATGGTA
          ATTTAAACAATTGCTAAACCAACTAGTACTAAAGACGAAGAGAACAAACTAGAAATTATACCGAAACGGAAATGAATAAA
          AATACATTCAAATAAACC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0078013
          3735
          FBtr0078015
          3583
          FBtr0332973
          2825
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0077679
          548
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0077678
          410
          FBpp0077680
          548
          FBpp0305189
          548
          Comments

          Translation start hypothetical (furthest upstream).

          Extended 3' UTR based on RNA-Seq and/or EST data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG3727-RB
          Secondary FlyBase IDs
            References (2)