Open Close
General Information
Symbol
Dmel\drongo-RC
Species
D. melanogaster
Annotation Symbol
CG3365-RC
FlyBase ID
FBtr0078037
Feature type
Associated gene
Evidence Rank
Length (nt)
2672
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 7 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ATTTCGGATGCTTTGGAGGGAGGAACTCTAGTGCTGCATTGATTGGGGCGTGTGTTAATGATATTCCCAGTTCGCATGGC
        GAGCATCGATTCCTGGTACGTATGTGGGCCCCTTGACTCCCACTTATCGCACTTGTCGTTCGCAATTTGCATGAATTCCG
        CTTCGTCTGAAACGCACTTGCGCCAGACTTCTCCGGCTGGTCTGATCTGGTCTGTGATCCGGTCTGGTGGGGCGCCAGTT
        GCGTTTCGAGCTCATCACCAGTCACTCCGCAGTCGCATTCTGCCAGAGGTCTCCGATCAAGAGCGCTTCTCCATTCGAGA
        TTCAAACGCAGCGCGGTCTGACGCCGCCACATCGAGTGAAATCCATATCGATGGCCACATTCACACAGGACGAGATCGAC
        TTCCTGCGCAGCCATGGCAACGAGCTGTGTGCCAAGACCTGGCTGGGATTGTGGGATCCGAAGCGGGCTGTGCACCAGCA
        GGAGCAGCGCGAACTGATGATGGACAAGTATGAGCGGAAGCGATACTACCTGGAGCCGGCCAGTCCTCTTAAGTCGCTGG
        CCAATGCGGTCAACCTGAAGTCGTCTGCTCCGGCGACGAACCACACTCAGAATGGCCACCAAAATGGGTATGCCAGCATC
        CATTTGACGCCTCCTGCTGCCCAGCGGACCTCGGCCAATGGATTGCAGAAGGTGGCCAACTCGTCGAGTAACTCTTCTGG
        AAAGACCTCATCCTCGATCAGTAGGCCACACTATAATCACCAGAACAACAGCCAAAACAACAATCACGATGCCTTTGGCC
        TGGGTGGCGGATTGAGCAGCCTGAACAGCGCCGGTTCCACATCCACTGGAGCTCTTTCCGACACCAGCAGTTGTGCTAGC
        AATGGCTTCGGTGCGGACTGCGACTTTGTGGCTGACTTTGGCTCGGCCAACATTTTCGACGCCACATCGGCGCGTTCCAC
        AGGATCGCCGGCGGTGTCGTCCGTGTCCTCAGTGGGTTCCAGCAATGGCTACGCCAAGGTGCAGCCCATCCGGGCAGCTC
        ATCTCCAGCAGCAACAGCAGTTGCAGCAGCAGCTGCATCAGCAGCAGCTCCTCAATGGCAATGGTCATCAGGGCACTGAG
        AACTTTGCCGACTTCGATCACGCTCCCATCTACAATGCAGTGGGTGCTCCCTTGCAGAACGGCCATACGACCAGTCCGCC
        CAAGGGCGGAAATGCAGCGATGGCGCCCAGTGAGGATCGATATGCCGCTCTTAAGGATCTCGACGAGCAGCTGCGAGAAC
        TGAAGGCCAGCGAAAGCGCCACAGAGACGCCCACGCCCACCAGTGGCAATGTTCAGGCCACAGATGCCTTTGGTGGAGCC
        CTCAACAACAATCCAAATCCCTTCAAGGGCCAGCAACAGCAGCAGCTCAGCAGCCATGTGGTGAATCCATTCCAGCAGCA
        GCAACAGCAGCAGCACCAGCAGAATCTCTATGGCCAGTTGACGCTCATACCAAATGCCTACGGCAGCAGTTCCCAGCAGC
        AGATGGGGCACCATCTCCTCCAGCAGCAGCAGCAGCAACAGCAGAGCTTCTTCAACTTCAACAACAACGGGTTCGCCATC
        TCGCAGGGTCTGCCCAACGGCTGCGGCTTCGGCAGCATGCAACCCGCTCCTGTGATGGCCAACAATCCCTTTGCAGCCAG
        CGGCGCCATGAACACCAACAATCCATTCTTATGAGACTCAACCCGGGAGAATCCGCCTCGCGCCACCTGGCAGAGGCGCT
        GAGCCAGCGAACAAAGAGCAGACGCGGAGGAACCGAACCGAAATTAGTCCATTTTACTAACAATAGCGTTAATCTATGTA
        TACATAATGCACGCCGGAGAGCACTCTTTGTGTACATAGCCCAAATATGTACACCCGAAAGGCTCCACGCTGACGCTAGT
        CCTCGCGGATGGCGGAGGCGGACTGGGGCGTTGATATATTCTTTTACATGGTAACTCTACTCTAACGTTTACGGATACGG
        ATATTTGTATTTGCCGTTTGCCCTAGAACTCTATACTTGTACTAAGCGCCCATGAACACTTCATCCACTAACATAGCTAC
        TAATCCTCATCCTAGTGGAGGATGCAGTTGGTCCAGACACTCTGTTATTTGTTTTATCCATCCTCGTACTTGTCTTTGTC
        CCATTTAGCACTTTCGTTGCGGATAAGAACTTTGTCAGTTATTGATTGTGTGGCCTTAATAAGATTATAAAACTAAATAT
        TATAACGTACGACTATACATATACGGATACAGATACAGATTCAGACACAGTTAGTACAGATACAGATATACATATACGCT
        TTTGTACCTAATGAATTGCTTCTTGTTTCCATTGCTAATCATCTGCTTTTCGTGTGCTAATTTTATACACTAGTACGTGC
        GATATCGGCCGTGCAGATAGATTGCTCAGCTCGCGAGTCAAGCCTCTTTTGGTTGCACCCACGGCAGACATTTGTACATA
        TACTGTCTGATTGTAAGCCTCGTGTAATACCTCCATTAACACCACTCCCCCACCACCCATCCATCGAACCCCGAATCCAT
        GACTCAATTCACTGCTCACATGTCCATGCCCATGCCTTAACGTGTCAAACATTATCGAAGCCTTAAAGTTATTTAAAACT
        ACGAAATTTCAATAAAAACAAATAAGAACGCT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0302120
        3986
        FBtr0302121
        3143
        FBtr0302612
        3518
        FBtr0334763
        2625
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0077701
        447
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0291330
        673
        FBpp0291331
        603
        FBpp0291768
        517
        FBpp0306804
        514
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        5' UTR based on RNA-Seq data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG3365-RC
        drongo-RC
        Secondary FlyBase IDs
          References (2)