Open Close
General Information
Symbol
Dmel\U2af38-RA
Species
D. melanogaster
Annotation Symbol
CG3582-RA
FlyBase ID
FBtr0078133
Feature type
Associated gene
Evidence Rank
Length (nt)
1261
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 90 )
Sequence
GCAACTCTAGATTCGAGGCTGGCAACGCCGTGCAAAATACGACCAGACGCTGCTTTTTTCGGTTTCCGAAAATAATTGAA
AATTATCACTAAATAAACAGGCGGCTAACATAATTGCAGTTTGACCGCGTTGCAGAGACAAGCGGGTAGATAAGTTACAC
ATTTTGGCCACAGCAACACCACAGTAAAGCCGCCAGCATGGCCGAGTACTTGGCATCCATTTTTGGCACGGAAAAGGACA
AGGTGAACTGTTCGTTCTACTTCAAGATCGGCGCCTGCCGCCACGGCGACCGGTGCTCTCGCATCCACAACAAACCCACT
TTCTCGCAGACGGTGCTTCTCCAAAATCTATACGTGAACCCCCAAAACTCCGCCAAATCCGCGGATGGCTCCCATCTGGT
GGCCAACGTCTCCGACGAGGAGATGCAAGAACACTACGACAATTTTTTCGAGGACGTGTTCGTAGAGTGCGAGGACAAGT
ACGGGGAAATCGAGGAGATGAACGTGTGCGACAACCTAGGCGACCATCTGGTCGGCAATGTGTACATCAAATTCCGTAAC
GAGGCTGATGCGGAAAAGGCGGCAAACGATTTGAACAACCGGTGGTTCGGTGGTCGACCGGTGTACTCGGAACTATCGCC
GGTGACCGACTTCCGCGAGGCTTGCTGTCGGCAGTACGAGATGGGCGAATGTACCCGCTCCGGCTTCTGCAACTTCATGC
ACTTGAAGCCCATCTCGCGTGAGCTGCGAAGGTACCTCTACTCCCGCCGCCGTCGTGCCCGCTCCCGTTCCCGATCCCCT
GGACGCCGTCGCGGCTCCCGCAGCAGGTCCCGATCCCCGGGTCGAAGAGGAGGCGGCAGAGGCGACGGTGTCGGCGGAGG
AAACTACTTGAACAACGAGCGGGACAACATGCGTGGCAATGATCGCGGAAACGATCGCGATCGCCGCAAAGGTGGTGGCG
GAGGAGGCGGTGGTGGTGGTGGACGGTATTAAATATTCTGGACATTTTTTCTGTACGGTGGCAATTGAGAGAGAAAGCAA
CGGACAAGCAGTAACGCAAAGCATCGTGTATTTTAGTCTCTGCGTTGGTTTTCCACGTTTTTATATCACTTTTGAGTAAA
CGAGATGGAAGGAGGAGGAGGAAAATGACGATGGGGAGTTCCACCACCTATGTACAAACCCCCCGCGAAATATTTTACCG
AGCGCCCATTAGAATTGTAATTTACTATACATACATTCATAATAATAAAATTGAGTAATAT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0333408
1655
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0077792
264
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0305600
264
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
U2af38-RA
Secondary FlyBase IDs
    References (2)