Open Close
General Information
Symbol
Dmel\CG3634-RA
Species
D. melanogaster
Annotation Symbol
CG3634-RA
FlyBase ID
FBtr0078272
Feature type
Associated gene
Evidence Rank
Length (nt)
2315
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 58 )
Sequence
GCTGGTATTTACCCCCCGCTCATCCCCTTTCGAATACTTGATTGAAAAAAGTCTCATCAGCAGCAAGGATACGCGCAAGG
ATAGCGCCAAGAAAGGCAACCGTTAATTGATCTAACCCCTCGGCGGTGGTCAGTGCCAGAGCACAGAGTATCCGCGAACC
CCCAGGCACAAGCTAATCCCGGAGAGCGGCAAAATCCGGACGGAGCTGGGGCCAAAGCGAAACGAGCGTCGAATACAGAA
CTTCGCAGGCAGGGGGCAGCAGGCAGCAGGATGTGGGATTCGTCCATGTTTCTCAGCACTCTGACGCCTAAGTTCTACGT
GGCGCTCACAGGGACCTCCAGCCTGATCTCGGGCCTGATCCTGATCTTTGAGTGGTGGTATTTCCGGAAGTATGGCACTT
CGTTTATAGAGCAAGTCTCTATCAACCACATTAGCCCCTGGATAAATGGCAGCGATGGCCAATCAGAGTCCAGCAATGGC
AGTGGCAGCAGCAGCAGCAGTGGCTCCAGCAGCAGCAGCAATGGCGGAGCAGGCGGAGGAGGATCGGGTGGAGCAGGGGC
ATCAGGCAGTGGCAGCGCCACCACAAGTACGGGCACCCAAATGCCCGAGTGTAAGGTCTGGCGAAATCCACTTAATCTAT
TTCGCGGCGCCGAGTACCAGAGATTCTTTTGGGCCACCAGCAAGGAGCCGTTGACCTACTACGACATGAACTTAAGTGCC
CAGGACCATCAAACATTTTTTACCTGCGAAGGCGATGCCCGCAAGGAGGAGTATGAGATCATGCAGACGGCCTGGCGCGA
ACGCAATCCCATGCAGCGCATCAAGTCCGCTCACAGTGCTCTGGAAATCAATGCGGAATGTGCACCTGCCTATATACTGC
TGGCCGAGGAGGAAGCCATGACCATTATGGAGGCGGAGAAGATCCTGAAGACGGCCCTAAAGGTCGCCGAGATCAACTAC
CGCAAGTCGCAGGCCACCCAACACCAGGGCGCCATTGCGGATGGCATGCATCGGCGCGACACCAATGTGCTGATCTATAT
CAAGCGACGGCTTGCCATGTGCGCCCGCAAGCTGGGCAAGCTGAAGGAGGCGGCTAAAATGTTTCGCGATCTCACCAAGG
AGATACCCTCGATCATGAGCGTACTGAACATTCACGAGAATCTAATCGAAACGCTGCTGGAGATGCAGGCCTACGCCGAT
TGCCATGCCATTCTGGCCAAGTACGATGACATCTCGCTGCCGAAATCGGCGACTATCTGCTATACAGCTGCTCTGCTGAA
GGCGCGCGCCGTAGCCGACAAGTTTTCGCCAGACATAGCATCCAAGCGAGGTCTAAGTCAAGCTGAAATGAGCGCCGTTG
AGGCCATTCATCGGGCGGTGGAGTTCAATCCGCATGTGCCCAAGTATCTGCTTGAGACAAAGCGACTTATTCTACCGCCA
GAGCACATTTTGAAGCGCGGCGATTCGGAGGCGTTGGCCTACGCGTTCTTCCATCTGAAGCACTGGAAGCAGGTGGAGGG
CGCCCTGAACCTGCTGCACTGCACCTGGGAGGGCACGTTTCGCATGCTGCCGTATCCGCTGGAGCGTGGCCACCTCTTCT
ATCCATATCCAACATGCACAGAGTGCGCGGATCGCGAACTGCTGCCGGCGTTCCACGAGGTGTCTGTTTATCCTAAGAAG
GAGCTGCCCTTCTTCATCCTGTTCACGGCGGGACTGTGCTCCATTACCGCCCTGCTGGCCTTGGCCACCCACCAGTATCC
GGAGCCCATGGGTCATTTGGCACAGACCGTACTTACCTGGATATCGTATCCATTTCAGCTGCTCAAGGAGCGTATCGAGG
CGTTCTGGCCGTGCAATCTGCTGCAGCAGTTGTCTCGCGTCTAAGCCGGAGGTCACACACTCCTCCACTTTCCACCCTCG
AATGACGTCACACACACTCACACAAAACTAAGAACACCACACATACTCACACGCATCCATCTCCATGTGGCTGAGAAGCA
AGCGGGCAGAAGGCCACGGAACCACTCAAAACACAAACCTTAAACACAAAACATACATATATATATATATATATATATAT
ATATAACGTATATATATTTTGGATCTTAATATGTCTGTGTTGTCTTCGTGAAATAAACATAAAGAAAGCAAATGCAAGCA
AACACGCACTCAACTAGTTCCAGCTTCCAAGTGATCCGGATGAACGAAACGAATTTTCAGCAGCCACGCAAGAGGAAACT
AAATTACTTTTAAGTTTTATTATTATTTTAATTATTGTAAACGAGTACGAGAAGCGAGTAAACTTAAATTCAAAC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0331528
2025
FBtr0331529
2056
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0077930
537
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0303918
537
FBpp0303919
537
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG3634-RA
Secondary FlyBase IDs
    References (2)