Open Close
General Information
Symbol
Dmel\siz-RB
Species
D. melanogaster
Annotation Symbol
CG32434-RB
FlyBase ID
FBtr0078289
Feature type
Associated gene
Evidence Rank
Length (nt)
5130
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 40 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CCACACTGTTTCCAAACGTCGAACGACGAGTGCGTCGTGTTTTTCGTCGCGCGTGAATTGAAAATCCGTAATTCCGAGAA
        TATTCGTAATCCCCCTCCGATCCGCACCAACTGTTGCTCGCGATTCGAAGTGCTGGCTCTGAAGTATAATATACGAAGGT
        CATTCAATTACAATACGAGTGAAGTTTCAACTCGCAGCAAGCTGCATTTTCAGTTCTTATTGTGAGATTCAAAGTGGTTC
        TGCCTGTTTCGCTGTTTTATCACCCTCTCCACCACCTTCCCTCATTCGCGCGAGTGCGTGTGCGTGGCGGGGCTATAATG
        TTTTGGCCACAAAAGCACATCGATTAGGAGTGCAGCCGATCCCCGCTAAGGTTATAAACAAAACATGTCCGAGGCCGATC
        TGAAGAATCTATCCCAGAACTCGGATGGCGACCAGGAATTGCTGCTGCATCAGACCACGCAGTCCCTGCTGATGGCCAGC
        TCCATAATGTTTGTGGGAAACCAAGGAGGGCCGGGCGGTTCCGCTGGGGGTGTCGCCCCACCTGGACCCGTTTCCCTGCC
        CCTGCCCCTCTCCATCAACATGCCCCATCACCATGTGCATGCGATGCCCTACAATGTGGACGAGCTGCTCCGGGAGAACA
        ATGCCCTGCACGCCAAGATCAAGGAGTTGAGTCTGGAACGCGATCGCCTGCTCTGTGAAGTGTCCAATCTGCGACTGGAG
        CTGGACATGTCGGAGCTCAAGCGACTGCCCGTCGATCTCGATGATAACTTTCCCCAGAAGAGCCTGGAGCGAAGTGGTTC
        CACCCAGTATGAGCTGGCTGGAGCGCAACAGCCAGGATCAGCCAACGCCTCCACCTGCACAGATAGCGGCAGTGTTGGCG
        GCTATGTTTACCTGCAGAATCACTACGCCCCCGGCGCCCACAGCTCCTCAGCCGCCATCAACTACCCTGCGCAACAGCAT
        CCCCAGATGGTCTACCAAATACAGCAGTATCCCACGTGCCATCAGCAGCAGCAACAGCAGCACCTCCAGCAGCAGCAGCA
        TTTGCATCAGACCGGCGCAGGTCACTACATGCAGGTGACGGCGACGGGTGGTGGCCAGTATCATCACCATCACATGCTCC
        ATGGTCACGGGCATCATGCCCACCATCACGGTGGGGCGGTGGTCATCGCCGGGAGTGGTGTGGGAACTGGCCTGGGATCT
        GGAGCCACCAGCGTGATCATGCAGCACCAGCAACAGCAGCAACAGCAACAGAATATGCACAAGAAGAACTCCATCCGGAA
        CGGCGGAGATGTCCTCAAGCGAACGCGAGCTCAGTCGGCCTACGAACTCTCACAAGATCTGCTTGAGAAACAGATCGAGC
        TGCTGGAGCGCAAGTACGGCGGAGTGCGAGCCCGTAACGCAGCGGTCACTATTCAGCGCGCCTTCCGTCACTACATGATG
        GTCAAGAAGTTCGCCTCGATCACGGCAATGGCCAAAGCTGAGAAGCGTCTAAGCCGGCGGATGGTGGTTACAGCCAGCAG
        TCTTGGATTGGCGGAGGAGGGTGCCTCCTCCTCGTCAGCCTACGGAAGTGCCACGGAATCTCAGCTCACCGAGCAGCAAC
        AGCAACAACAGGCGCAGCAGCAACAGCAGCCACGTGTCACCATCATGGCGGGTCCGGCGGGAGCAGCTTCTCCGGGCTTA
        TCCCGGACGCCACCTACGCGATCGCTTTCCATGCGGGAGCGACGTCAGCTGGACTGCAGTCCCATACCGCGTAGTCAGTC
        AGGAGCCTCTCCCGCCTCCATATCGAGCTCGACAGTCAGCACATCGGCTCTGGCCTCACATCCACATGTTAATCTGCTGC
        ACGCGGCAGAGCCACATTATTATAATGCTCAGGCACTGCCCCAGGGAGCTGCTTACTACACTAGTTACCATGGATCACCG
        CACGACTTGAGCTATGCCAGTTCGGCGGACACCTCGCTAAATGCCTCGTGGGTTAACACGAGCGGCCACTCCCCGCACAC
        GCCCTACTATTCGGCGGCCCAGATCTATATGCGACCCAAGGGCGGCAGCACCACGCCCACGCCCAGTTGCAGTGGCAGCA
        CAGGTAGCGGCAGCGGAGGCAGCGGGAGTGGCAGTAGCAAGAAGGTGCCACCAGAGGTGCCCAAACGCACCAGTTCCATT
        ACGGCACAACAGCAGACACAGCTTCTTTTGCTGCAGCGCCAGACACCGCCGCCTCCTTCGCTGCTAAGGACCAATGGCCT
        GTGCAAAACCGCCGAGAACGGCAGTCTGACCTCCGTGCAGAGTTCCGGATCGGATTCTAGTGTTACCTCTGCGGAACGCA
        ATCTAAACAGCGATTTGGGCTCGGATCGCAGTAACTCACCACATACATGGAAACGAGGAACAGCCCTAAATAGTTCCCAG
        CAGTTCTCCACGCACTCGGCGGATTCAGCGGGTGCGGTGTCTGGTGGAGGAGTTGGAGTGGCTGGAGGAGCCGGCGTTTA
        TGCCGCTCAAATGCAGGCTGCCGTTGCAGCAGCTACAGCGGCAGGAGGAATGCCACCAGCGGATGACCATGCTATCTCCT
        CGCATACGAGTGCCGCTCAGTATGAGCAGCATGAGCAGCAGCAGCACGAGCAACAGCAATTGCAGGCGGCAGCTGCAGCT
        GCCGGAGTGGCACAAAACTACAAGATGTCGGAGACGATACGCAAGCGACAGTATCGCGTTGGACTCAATCTGTTCAACAA
        GAAGCCGGAGAAGGGCATCACCTATCTGATCAGGCGGGGATTCCTTGAGAATACACCACAGGGCGTTGCTCGTTTCCTCA
        TCACCCGTAAGGGTTTGTCCCGGCAAATGATTGGCGAGTATCTGGGAAATTTGCAGAACCAGTTCAACATGGCCGTGCTC
        AGTTGCTTTGCCATGGAGCTGGACCTGTCCGGCCGGCAAGTGGATGTGGCTTTGCGAAAGTTCCAGGCCTATTTCCGCAT
        GCCTGGAGAGGCACAAAAGATTGAGCGCCTCATGGAGATCTTTTCACAGCGCTATTGTGAATGCAATGCGGACATTGTCG
        GGCGATTGAGATCATCCGATACGATCTTCGTCCTGGCTTTCGCCATCATCATGCTGAACACGGATCTGCACACACCCAAT
        CTAAAGCCAGAACGTCGCATGCGCGTCGAGGACTTTATCAAGAATCTGCGCGGCATCGACGACTGTCACGACATTGATAA
        GGACATGCTGATGGGCATCTATGACCGTGTCAAGTCCGACGAATTTAAGCCCGGCAGCGACCATGTCACTCAAGTGATGA
        AGGTACAGGCCACTATTGTGGGCAAGAAACCAAATCTAGCGCTGCCCCATCGGCGTCTTGTCTGCTATTGCCGACTGTAC
        GAGATTCCTGACGTGAACAAGAAGGAGCGACCTGGTGTGCATCAGCGCGAGGTGTTTCTGTTCAACGATCTGCTGGTCAT
        TACCAAAATATTTAGCAAAAAGAAGACCTCCGTGACGTACACATTCCGCAACAGTTTCCCGCTATGCGGCACCGTTGTCA
        CCCTTCTGGACATGCCCAACTATCCGTTTTGCATTCAGCTCTCCCAGAAAGTGGATGGCAAGATCTTGATCACCTTCAAC
        GCCCGCAACGAACACGATCGCTGCAAGTTTGCCGAGGATCTTAAAGAGTCCATTAGCGAGATGGACGAGATGGAGTCGCT
        GCGCATTGAGGCCGAACTGGAGCGCCAGAAGTCGGCGCGCAATCGAGCACCTGGCAATGCGGAGAATCGTGACAGTGGCG
        TAGCCGATGTGGAGGTCTGCCCATGCCCGTATCAGCAAGGATCACAAGCATCTGGCGAGCAGGCTCCAAACTCTGCCGAT
        AACTCGCAGCAGCTGAAGCGCAGTGCGCTGAGCAACAGCCTTCTCGACATGCACGAGCAGTTTGGCAATGAGAAACCTCA
        ACGTCGTGGCAGCGTTGGCTCCCTGGACAGCGGCATGAGCATCTCGTTCCAGTCCACTACAACATCCAGCGCTTCGAGGG
        AAAATGCCGCTGCCATTGCGGCCGCAGCAAATGCAGCTGCAGCAGCCAAGATGCGATTTAACATGCCGCCAACGGCAGCG
        ATTGCCACGCCCAGCAATGTGTATGCAGCTCCGGGAATGCAGGCGTATACCCATGCCAACTTTGTGCAGCAGTCACAGGC
        CGCCTACATGTTGCAGCAACAGCAAATGCTCCAGCAGCAGGCACAAATGCAAGCTCAGGCTCAGGCTCAAGCCCAAGCTC
        AGGCCCAAGCTCAAGCCCAGGCTCAGGCGCAGGCGCAGGCGCAGCCGCTTACTGGCCGAATACCGGGACGCGAGCGAAAG
        GCTTCGCGGACGGATGAGAACGGACGGTCGACGGAGGTCTAAGTCATCTATTGTACATTTTAGTTATTGAGCAAAGCGAT
        AATTATAATATCTATATAGCATATTGAATGAAATATCTGTATAATCCGAATCGAAACGACCCGAACGCCATTTTCTTCAA
        CACCTAACCCACACACAGCGTACGAGTATATAGTGAATTCTTAATGTTCCTTCGTTCTCTGCTAATATTAATGTAAATAA
        ATTAAACATTTGTCTGTTTTACACTATCTACACACTAAAATAAGTTTCTAAAACTATTTGTATATACATCAGCATACTAT
        AATACACCCACAATCTATGAAAATTATTCTCTAAATATGCATATGTATTATTGTATAACTCTAATCCTCTCCAGACACTT
        GAAACACCAATTTACCCCTGGGCAACCTTCTATGCCCATACCCGTTTTGATCTACCCCTCCCCTTACGAATTACAAAAGC
        GATTGGCGAAAGTAGTTTCATTAGCATATACTAAAAACTATATCCCGATAAGTGCGCGCTATGTATATTATATATTTTGT
        TTACCCTACATTTTCTCTGTGTAACTAAAAAGTGAAGTTCGTGTATACCGCGTGTGTGTGTATATACCCTGAATATTAAT
        TTAAAAGCATTTAGCTATAATTATTCATATTTATAGAGCCAAAACTACCCAAAACCTAAAATATTAAATACGAGTATAAC
        AAACACGAAGTATATGAAAACAAAACAATATGTATATGAAAAAGCAAAAGACTTAAAAATTTCAATAAATGAAAAGAAAT
        AATACCAATG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0078290
        5314
        FBtr0111038
        4654
        FBtr0301602
        4931
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0077947
        1325
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0077948
        1313
        FBpp0110337
        1210
        FBpp0290817
        1220
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (4)
        Reported As
        Symbol Synonym
        CG10577-RB
        CG32434-RB
        loner-RB
        Secondary FlyBase IDs
          References (2)