Open Close
General Information
Symbol
Dmel\CG11309-RB
Species
D. melanogaster
Annotation Symbol
CG11309-RB
FlyBase ID
FBtr0078406
Feature type
Associated gene
Evidence Rank
Length (nt)
1430
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 18 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TGTGCAAGTTTAGTGAACAGCTGTAGTAAGTGTTTATTTTTCGTTCGCTCGATGCTTTCACCTGTTTGTTGGGCGCATTG
      GTAATAAAATTATTCGAATGAAATCAATTCTGTATTAATTAGGAGGGAGCACAAGTATATTAAACAAATTGCAAAAAAAT
      CTGTGACACAAAGACAACGTCGTTACTGATAAGGGCCGAAATCGGCTAAACTTTGGAATTGGTGCTCATTCGCTTTTTGG
      CCACTTTCGAGCGCAGAAATGGACACGGACGACAACTCAAGTGGCACTATTACCGGCAGTGATCTTGGCCAGCGTTATCG
      GCATGCAGGCGACTTAACTGGCGAAGCCCCAACCAGACCCTTCGCCGAGATCAGCATTACGGTTCCATGGGGGCACATAT
      CCGGCAAGTGGTACGGTCCGCAGAACGTCCAACCAATTTTAGGACTGCACGGGTGGCAGGATAATGCGGGAACCTTTGAT
      CGCCTGATGCCGCTGCTGTCGCCGGACGTGGCATTCCTCGCGATCGATCTTCCTGGTCACGGGCTATCGTCCCGACTGCC
      TGATGGCTGCTACTACAACTCCGTGGATAATCTGTATGTGATCCGCCTGATCATGAAGCAGTACAAGTGGGAGAAAGTGT
      CCCTGGTTGGACACTCAATGTCGTCCATTATTTGCTTTGTTTTCGCCGCGGTCTTTCCGGACAAGGTGGACATGATCATT
      GGGATTGATGCCCTGAAACCTCATCAGCGTCCGTATCCGTCGGTTATTAGGACCATGGAAACCCGTTTGGACGAGTTCTT
      GCGTGAAGACGAAAGGAACCGGAGTAAGAACGAGCCGCCGAGCTACACCTACGATGAACTTATTGAGAGGGTCTATATCG
      GCACCTTCCATTCGGTGAACAAGGAGCACTGCAAGCATTTAATGGCTCGCAACATCGGCAAGTCGGAGAAGTACCCGGAC
      AAGTACTTCTTCTGCCGCGATAGGCGTCTCAAGTTTTACAACTATGCCATCGGGTCCCAGGAGCTGTGTGTGGAAATGGC
      CAATCGGATTACATGTCCTTACTTGTTCATCAAGGCCGCCCAGTCCTCGTATTTCGAGGACAAGAAGTACTACGACGAGG
      TGCTGGATGTGCTGTTGAAGAAGCCGAACTTTGAGTACCTGGAGGTTAATGGCTCGCACCATGTGCACATGAACGATCCA
      GAGGCCATCATTGCACCGGTCAACAACTTTATCCAGCGCTTCGGACCGGCGGCAGCGGCTGCATCCCGCCAGAAGGCCAA
      GGAGGCGAAGGAGAGCAAGCTTTAGGCCAACGGTGTGGTAAATAGAGCTTATTTATTGTAGTACAGATTGTACAGGTTTT
      TATACTTAATTGTTTATGCTATGTGATCGCGGCAGAGGACTCGGCTCTGCTATAAATACACAATGTACAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0078407
      1664
      FBtr0321282
      1302
      FBtr0321283
      1536
      FBtr0331798
      1206
      FBtr0345883
      2125
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0078060
      348
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0078061
      358
      FBpp0302828
      348
      FBpp0302829
      348
      FBpp0304183
      348
      FBpp0311813
      348
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG11309-RB
      Secondary FlyBase IDs
        References (2)