Open Close
General Information
Symbol
Dmel\NPFR-RA
Species
D. melanogaster
Annotation Symbol
CG1147-RA
FlyBase ID
FBtr0078590
Feature type
Associated gene
Evidence Rank
Length (nt)
3214
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 7 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ACGCAACGCGCCCCGGCAAACAGCAAATCAGGCGGATATATCGGCGGGACTAGGGTATATAAGCAGGAGATGCGCACCAA
      AAGCCAACAGATGGTCGCTGACTGTGCACGCGTGTGGTTATCGGAGATCAGTAAACAGCCCAACTAAACACCGAAACTTA
      CTGTAATAAAAAAAAACGGGAAATAAGCGAAATAATCAAAATGCGGCCGCATACTTATTTATAATTTTGAGGCGGCCGAG
      CACCGGGGCCCCAAACTCTTTGGATCTGCACGGAATCCAGAATTCCGAGAGAGCAAAAACACAAAGCGAAGTCCCGTGAG
      TGCATTCCAAGTTGAAAACTAAGTGAGCAACTGCTGCTTTGGCAGCCGGAAAAACAGAGATTCACTCGTGTCACTCGCAG
      AAGGAAAAACAAGAACCGACGGCCAGGAAAACAATACGGTACCACGCACTATAGTAAATATATAGCATACATATCCCCAG
      GGCGAAGGAGATTGCCAGGACGATGATAATCAGCATGAATCAGACGGAGCCCGCCCAGCTGGCAGATGGGGAGCATCTGA
      GTGGATACGCCAGCAGCAGCAACAGCGTGCGCTATCTGGACGACCGGCATCCGCTGGACTACCTTGACCTGGGCACGGTG
      CACGCCCTCAACACCACTGCCATCAACACCTCGGATCTGAATGAGACTGGGAGCAGGCCGCTGGACCCGGTGCTTATCGA
      TAGGTTCCTGAGCAACAGGGCGGTGGACAGCCCCTGGTACCACATGCTCATCAGCATGTACGGCGTGCTAATCGTCTTCG
      GCGCCCTAGGCAACACCCTGGTTGTTATAGCCGTCATCCGGAAGCCCATCATGCGCACTGCTCGCAATCTGTTCATCCTC
      AACCTGGCCATATCGGACCTACTTTTATGCCTAGTCACCATGCCGCTGACCTTGATGGAGATCCTGTCCAAGTACTGGCC
      CTACGGCTCCTGCTCCATCCTGTGCAAAACGATTGCCATGCTGCAGGCACTTTGTATTTTCGTGTCGACAATATCCATAA
      CGGCCATTGCCTTCGACAGATATCAGGTGATCGTGTACCCCACGCGGGACAGCCTGCAGTTCGTGGGCGCGGTGACGATC
      CTGGCGGGGATCTGGGCACTGGCACTGCTGCTGGCCTCGCCGCTGTTCGTCTACAAGGAGCTGATCAACACAGACACGCC
      GGCACTCCTGCAGCAGATCGGCCTGCAGGACACGATCCCGTACTGCATTGAGGACTGGCCAAGTCGCAACGGGCGCTTCT
      ACTACTCGATCTTCTCGCTGTGCGTACAATACCTGGTGCCCATCCTGATCGTCTCGGTGGCATACTTCGGGATCTACAAC
      AAGCTGAAGAGCCGCATCACCGTGGTGGCTGTGCAGGCGTCCTCCGCTCAGCGGAAGGTGGAGCGGGGGCGGCGGATGAA
      GCGCACCAACTGCCTACTGATCAGCATCGCCATCATCTTTGGCGTTTCTTGGCTGCCGCTGAACTTTTTCAACCTGTACG
      CGGACATGGAGCGCTCGCCGGTCACTCAGAGCATGCTAGTCCGCTACGCCATCTGCCACATGATCGGCATGAGCTCCGCC
      TGCTCCAACCCGTTGCTCTACGGCTGGCTCAACGACAACTTCCGTAAAGAATTTCAAGAACTGCTCTGCCGTTGCTCAGA
      CACTAATGTTGCTCTTAACGGTCACACGACAGGCTGCAACGTCCAGGCGGCGGCGCGCAGGCGTCGCAAGTTGGGCGCCG
      AACTCTCCAAAGGCGAACTCAAGCTGCTGGGGCCAGGCGGCGCCCAGAGCGGTACCGCCGGCGGGGAAGGCGGTCTGGCG
      GCCACCGACTTCATGACCGGCCACCACGAGGGCGGACTGCGCAGCGCCATAACCGAGTCGGTGGCCCTCACGGACCACAA
      CCCCGTGCCCTCGGAGGTCACCAAGCTGATGCCGCGGTAAAGCACAGGGTAGTCCTAAGGTCCTTGAGGTCTGGTCTCGT
      GTCTAAGTCCTCATGATACACGCGTGCATGTCCTTTTGTACGCCCTCGGGCTGATTGGATTTGCATGCTCCAAACGTCGC
      TGCTGCTCGCTTTACGTTTCACTTGTTCCAACTGCAACTGCCACCTCTCTAGAACACTGAGCGAAATGCCGTGTCCTCTA
      ATCGGGAAACACTCTGGCTGTAAAATCTATAAGCAGCCGAGTCAAACGTTTCTAGCGTTCTAAAAGTTTCTTATGATTAT
      TTTATTTTATATATTAATAACAATGACTTCGTTCCCAATTATATGCTTGTTTTCATCGTTTTTGAATGTAACAATTGATC
      AATATTCGACCAAAAGCAAGTTTTGAAATATTTGTGTAAATATCGTTTTCAAATTTGTTCGCCTTAATCTTACTTAATAA
      TAATAATAATAATAATCTTTACTCCGATAATCATTAACGTAACATTTCTACTTGTAAAAATATTTCTGATCTAAGGGGCT
      TGCTCTTTTCGGCTCCACCTTGAATTACTTTTCAGTTGACTAACTAGGCGTATATTTTTGTCAGTGTATGCATGCGCTCC
      TCTTATCGTTGCCTTGTCGAGCTGTAACTCTTGTTGTTGCCATGTTGTGACATTATTTGCTTTTGAGCTGCAATCGATTA
      TGACCCGTCTTTTGTGACACATTTTCAGTTTGGAACAGTACTAAATTGGCAATCAATCCTGGAGCAGCAGGCGGCTGGAG
      CAGCATTCTAGGGAGGCGACTGCCTGTCACCCATAGACTTAACACGTATTGTCCAGTGATCCAAAGCCAAGCTGAGTTAG
      CCCTAAGTTAAGACACACGCGACTAAGAGCTCGAAGCCTGTAAACTATTCTTAAACGACCATGTCATGGCATCCATCATC
      AACTCGGACTAAGTCTATGGTTAGATCACTTTCGTATCAAATGCCGAAAAGTAATTGAATGAGCCCCCAATTAGATTTCG
      GGTATTTGATAAGTCGAATACGCCTAAGACTCGAATAAGTTCTCTCAACAGTTCCTAGGAAATATTTTCGTTTTATCTCA
      GCATTTCTTGGTATCATCTAAGCTAAGGATTAGCTATAATTGATGTTCTGTTCGCTATTCAATAATGATAGGATAGGTCG
      AAGTCCACTAAGCCAAAGTGAATTTAAAGTATAGTATAGTATAAAGTATAATTGTAAAAGATAACTTTAAAATAAATGTC
      AGCTGCTCTTAAAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0308316
      2433
      FBtr0308317
      2465
      FBtr0308318
      2502
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0078239
      485
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0300635
      466
      FBpp0300636
      462
      FBpp0300637
      489
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      Based on cDNA(s) with retained intron; results in premature stop codon and/or downstream start; may or may not produce functional polypeptide.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (3)
      Reported As
      Symbol Synonym
      CG1147-RA
      NPFR-RA
      NPFR1-RA
      Secondary FlyBase IDs
        References (2)