Open Close
General Information
Symbol
Dmel\CG2017-RD
Species
D. melanogaster
Annotation Symbol
CG2017-RD
FlyBase ID
FBtr0078662
Feature type
Associated gene
Evidence Rank
Length (nt)
2088
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 27 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CGAGCATAAACATCTGTTTGTCGGAGTCACAAAATCAACACATTATGGAGTCCTTCCTGAGTCTCTTTGATCCCAATCAG
          GACGACGGCTTCGAGGAAGAGCCCGAGCTCAATGGCAACAGCAGCGGCGGCGGAAGCAGCAGCAGCGACTATGAGACGGA
          CGCCAATGCCAACGAGTGCAGCGTAGTGAGCGGGATGCCCACCGAGCGGGGCAACCTGATCTTCGACTTCGAGCAGGGAA
          TGCTGCCACCAGAGCCGCAGCTCGGAAATGTGGAGTACAAGCTGAAGCTGGTCAACCCGTCGAAGCAGCGATTCGAGCAC
          CTGGTGACCCAGATGAAGTGGCGTCTGCGCGAGGGAAACGGCGAGGCCATCTACGAGATTGGAGTATCCGACGCCGGCTA
          TCTGCAGGGACTCAGCGACAAGGACATGAATGCCTCGCTCACCACGCTCAAGCAGATGGCCCACAGCCTAGGAGCCAGTA
          CCTCAGTGCTGCGGCGAAAGACCATCGCCGCCCGACGCGCCGTCGCCGAGGTACTGGTCCGTAAGATCCCCGACGACCAG
          CACAACATCGAGGTTCGGGTGGCGGTGCTCGGCGGAGCTGATGCAGGCAAATCCACTTTGCTGGGCGTGCTTACACAGGA
          CGAGCTGGATAACGGACACGGCCGGGCGCGGCTCAATATGTTTAGGCACATGCACGAGATTCAGTCTGGCCGCACCTCCT
          GCATCTCCCACGAGACGCTTGGCTTCGATGCACTGGGTAATGTGGTCAACTACAAGTACAATGAGATGATGACGGCAGAG
          GAGATTAGCGACAGGTCCAGCAAGCTGGTTACCTTCATGGATCTAGCCGGACACCGACGCTACATGCGCACCACCGTGCA
          GGCACTGAGTGGATACTCACCCCACTACGCCATGCTGGTGGTATCGGCGGGCAGCGGTTGCAACGACACCACCGAGGAGC
          ACTTGGCTATCGTGCGGGCACTGGACATGCCCTTCTTTGTATTGGTCACGAAGACAGATATCACATCGCCGGACGCGACG
          GTACAGGAGTTGTGCAACCTGCTCACCACCATTGGGTGCCGGAAGGTTCCCTTTGTGGTGACCAACACGGATGAGGCCAT
          CTCCGCCGGGTCAAACCAGATCTCCGAGAACATTGTGCCCATCTTTTGCGTATCGAATGTGACCGGCACGGGACTCAACC
          TAGTCACAAAGTTTCTGTACGTCCTTTCGCCCGGAATCAGCAACGCCGAGAAGGATCGACTCGAGCAGGAGTCTTGCGAG
          TTCCAGGTGGACGAGATCTTCCGGGTCTCTGACGTCGGACCCGTTGTGGGCGGTCTACTTGTCCAGGGCGTGCTGACCGA
          GAATATGGCAATGAAGATTGGTCCGCTTCCCGATGGTAGCTTTCATCCCGTTACTGTTAATACTATCCACCGAAACAAGG
          CTCCTTGCCGAGTTGTCCGAGCTGGTCAGAGCGCTTCGCTGTCTTTCAGTATGGATCAGGATGTGCCCACGCTACGAAGT
          GGCATGGTTCTTTTGGGTGATATTGGAAATAGTCTGGATGAGCCCTACGGGACCTTCTTCTTCCAAGCCAAGGTGTCCGT
          GCTGTTCCACGCCACGGCCATCTATGTCGGCTTCCAAACCACAGTCCACATAGGCAGCATTCGCCAGACGGCCGTCATTC
          GGGGCATTATGGGCGGCGAGCGACTGGGCACAAACGATTGTGCTTCGGTGATGTTCGAGTTCGTCGGCCACCCGGAGTAC
          GTGCGTCCTGGAATGCGCATCCTGTTCCGCGAGGGCACCAGCAAAGGAATCGGAGTTGTCACGCAGGTGTTTCCGGTCAA
          CAAGACAGGCATAAAGTAGAGAAGCGGGCCAGATGGATAGTTCCAATGACATATCTATATATCTCAAACAAAGATGACAT
          GTACATATACTTAATTAGCAATTAGAGGGAGGCGTTAAATCTTAGGCAGATCTTCTGTACACTTAGTTTCGGGTTCTGTG
          ATTTTTCGTTTAAGCTCGGCTCACAATCGGATGTTGTGAGTAATCCTTCTCAATTAACCTTATTTCATTAAAATCCACCC
          CAAAATGC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0078661
          2289
          FBtr0078664
          2368
          FBtr0078663
          2209
          FBtr0114518
          2144
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0078311
          604
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0078310
          643
          FBpp0078313
          604
          FBpp0078312
          604
          FBpp0113010
          604
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG2017-RD
          Secondary FlyBase IDs
            References (2)