Open Close
General Information
Symbol
Dmel\kra-RG
Species
D. melanogaster
Annotation Symbol
CG2922-RG
FlyBase ID
FBtr0078745
Feature type
Associated gene
Evidence Rank
Length (nt)
1614
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 199 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CTCTGTACCATTGCGTACGAAGCAGGCCACGGTCATACCGCAAGTCATCCAGAAGAAGCAGCCCAACAGCTACGCAAAAA
        GTTACTTTTATTCGCAGCAAAACAGATTTTTTTGTTTTAATCCAATTTATTGTATGAGTCAAAAAACTGAAAGACCAGTG
        CTATCGGGTCAACGCATCAAGACCAGAAAAAGAGATGAAAGAGAAAAATATGACCCAACGGGATTCCGTGATGCGGTCAT
        TGCTGGTCTCGAAAAAACTGAAGGCGACCTGGAACAAATCTCTAAATATCTAGACAGCGCGGGCAACAAGCTCGACTATC
        GTCGCTACGGTGAAGTTCTCTTTGACATATTGATTGCAGGAGGTCTACTAGTGCCTGGTGGTTCTATATCTCAGGATGGC
        GAAAAGCCGCGCACAAGCTACTGCATCTTCGATGCGCCCGAGAGCATGGAGAGCATGCGCAACCATGAGCAGGTATTTGT
        CAAGCTCATCAGACGGTACAAGTACCTTGAGAAAATGTTCGAAGAGGAGATGGGAAAGGTTCTATTATTCGTAAAGGGCT
        TTACTCCTAGTGAACGCATCAAGCTTGCGCGTATGACAGCGCTCTGGTTAGTCAACGGTTCTGTACCGCCAAATGTTTTA
        CTGGTACTAAACAACGAGCACCTAATCAAGGATGGCATTGCATTGGAGTTTCTACTAGAGCTGTTCCAGACGTTCAAGCA
        AGAGAAGGGCATTGCATATCTGATTCAGGCGCTTAAGAAGGGTGGACTGGAAAGCAAACTTATGGACTTTTTCCCACCGA
        ACAAACGTACTGAGGAATATTTTAAACAAGTTTTTCTTGACAAAGAACTTAACGAGATCGTCAAGCTACATAAGGCTCAG
        GCTAGCCAGGAGGCGAAGCGTGAGTTGCAGCAGGCGCTCATCGATGATATCAACGATGAGAAGCCATATAATGAGATAAC
        CTCAGACATTAAGGACTTCTCGCAGCGCACCAACATTCCCGATCATGAAATAATTGTTATTATTTGGTCCACCATCATGT
        CATTGGGCGAATGGAACAAGAAGGAGGAGCTGGTTACCGATCAGGCTGTTCGTCATCTGAAGAACTACTGCCCACTGTTG
        CAGGCTTTCGCCTCGACCGACCGTTCGGAATTGGCCCTAATCTTGAAGGTGCAGGAATTCTGCTACGAGAACATGAACTT
        CATGAAGGCCTTCCAGAAAATCATTTTGTTGTTCTACAAGACCGAGGTCCTGTCCGAGGAGATCATCTTGCGCTGGTACA
        AGGAGGGCCACTCAAACAAGGGCAAAATGCATTTCCTTGAACAAATGCGAAAGTTTGTCGAATGGCTTCAGTCAGCCGAA
        GAAGAATCCGAATCTGAGGACGAACAAAAGAATGGCGAGTAAGAACTTGGTTGATGGCTAAATGAGGATGAACACAAACG
        GAGCCGCCCTTTAGCATCCCCATCCAAAAATTCGAAACCAGCACCTGCAACAGCCAGTCGAACTATATATAAAACTCACC
        CCTATGAATTAATGTCATTTTGAAAACTCCACCTATATAAAACTCAAAAATTCCAACAAATAAAGGAGAGAGTAAAAAAA
        ACATGCTAGAAACT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0078744
        2123
        FBtr0078749
        1847
        FBtr0078746
        1906
        FBtr0078748
        2026
        FBtr0078750
        1701
        FBtr0078747
        1776
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0078394
        422
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0078393
        422
        FBpp0078398
        422
        FBpp0078395
        422
        FBpp0078397
        422
        FBpp0078399
        422
        FBpp0078396
        422
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (4)
        Reported As
        Symbol Synonym
        CG2922-RG
        eIF-5C-RG
        exba-RG
        kra-RG
        Secondary FlyBase IDs
          References (2)