Open Close
General Information
Symbol
Dmel\tkv-RD
Species
D. melanogaster
Annotation Symbol
CG14026-RD
FlyBase ID
FBtr0079089
Feature type
Associated gene
Evidence Rank
Length (nt)
3616
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 57 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTGCACATTCGTCGATACGTTCTTCGCGAGTCGTGACGTATCCACCGGATTGGAAAAATAAACCATATTTTGAGATACAA
        TCCAAAGAATCGTCGATTTTGTTTACGCGTGAAATATTTTCGAGTTTCAACCAAAAACCTGTGTGCCTAAGCTGAAATAT
        TGTTAACTAATGAAAAACGAATAATAAAAGTGCATCAACGGCAATCTATAGTTAATGATTTAAATGGGAAATTGCACATA
        TATTTCTATGCTTAAACAAGTGCCAGTGCGAATAAACAAAATAGTGTAAACACTGGGGAAAAACAACCAGAAACACACAG
        GATATGCCTTAACTGCGGATTGAGTTTCACCTGATTTGTATTGCCACCTTTCGTATATAATTATAATCAACGTGATCACG
        CGCTCACACCAAGCAAAAGCAAAAGCACATCGGCAGCAGAGCACCAACGCCACCACCGCCAGCAACAGCAGCAGGATCAA
        GTTTTTGGCGAAACCCATAATTTCGCTCATCTTCCTGCTCCTCTTCTTCTTCTTTTTCTTCGCGGGCTCCATGGTGTCGC
        CGGCTTGACCGCCGCCGCCTGCCTATAAACAAACCCAAGAGGAGTCCAACCCCAACTCCAGCTCCAACTTCGACTGCGAC
        GGCGACTCCATAACAACGCGAAGACTCGACGAGATACAACGAATCCAGTTCTCCTGGTGCTTTTGTTTTGCTTTCGTTGC
        TGCTGGCTGCCTCGCGTTTATTGTTTTGCTGCATAGCCCGGAAAAAATAAACGTGGCAACGAGGGGATATCGAAGGGGAA
        ACTGGCCCCAAAACACCCGGGATCCCGATACCCTCTCTATATAGAGAGGAAGGCCAACAAAAACAACCAAGAACGATCGG
        TTGGGGCAACAACAACTTAGTTGCATTGCAGTTGTTGCCGCCGTATAAAAATCATCAGCCTTTGGCCCACGTCGTTGCTG
        TTGTTGTTGTTGCTCTTGTTGTAGCCATCAGACATGGCGCCGAAATCCAGAAAGAAGAAGGCTCATGCCCGCTCCCTAAC
        CTGCTACTGCGATGGCAGTTGTCCGGACAATGTAAGCAATGGAACCTGCGAGACCAGACCCGGTGGCAGTTGCTTCAGCG
        CAGTCCAACAGCTTTACGATGAGACGACCGGGATGTACGAGGAGGAGCGTACATATGGATGCATGCCTCCCGAAGACAAC
        GGTGGTTTTCTCATGTGCAAGGTAGCCGCTGTACCCCACCTGCATGGCAAGAACATTGTCTGCTGCGACAAGGAGGACTT
        CTGCAACCGTGACCTGTACCCCACCTACACACCCAAGCTGACCACACCAGCGCCGGATTTGCCCGTGAGCAGCGAGTCCC
        TACACACGCTGGCCGTCTTTGGCTCCATCATCATCTCCCTGTCCGTGTTTATGCTGATCGTGGCTAGCTTATGTTTCACC
        TACAAGCGACGCGAGAAGCTGCGCAAGCAGCCACGTCTCATCAACTCAATGTGCAACTCACAGCTGTCGCCTTTGTCACA
        ACTGGTGGAACAGAGTTCGGGCTCCGGATCGGGATTACCATTGCTGGTGCAAAGAACCATTGCCAAGCAGATTCAGATGG
        TGCGACTGGTGGGCAAAGGACGATATGGCGAGGTCTGGCTGGCCAAATGGCGCGATGAGCGGGTGGCCGTCAAGACCTTC
        TTTACGACCGAAGAGGCTTCTTGGTTCCGCGAGACTGAAATCTATCAGACAGTGCTGATGCGACACGACAATATCTTGGG
        CTTCATTGCCGCCGATATCAAGGGTAATGGTAGCTGGACACAGATGTTGCTGATCACCGACTACCACGAGATGGGCAGCC
        TACACGATTACCTCTCAATGTCGGTGATCAATCCGCAGAAGCTGCAATTGCTGGCGTTTTCGCTGGCCTCCGGATTGGCC
        CACCTGCACGACGAGATTTTCGGAACCCCTGGCAAACCAGCTATCGCTCATCGCGATATCAAGAGCAAGAACATTTTGGT
        CAAGCGGAATGGGCAGTGCGCTATTGCTGACTTCGGGCTGGCAGTGAAGTACAACTCGGAACTGGATGTCATTCACATTG
        CACAGAATCCACGTGTCGGCACTCGACGCTACATGGCTCCAGAAGTATTGAGTCAGCAGCTGGATCCCAAGCAGTTTGAA
        GAGTTCAAACGGGCTGATATGTATTCAGTGGGTCTCGTTCTGTGGGAGATGACCCGTCGCTGCTACACACCCGTATCGGG
        CACCAAGACGACCACCTGCGAGGACTACGCCCTGCCCTATCACGATGTGGTGCCCTCGGATCCCACGTTCGAGGACATGC
        ACGCTGTTGTGTGCGTAAAGGGTTTCCGGCCGCCGATACCATCACGCTGGCAGGAGGATGATGTACTCGCCACCGTATCC
        AAGATCATGCAGGAGTGCTGGCACCCGAATCCCACCGTTCGGCTGACTGCCCTGCGCGTAAAGAAGACGCTGGGGCGACT
        GGAAACAGACTGTCTAATCGATGTGCCCATTAAGATTGTCTAAGCAGCTGTTTGTAGTCTCGTTTTAGGTTTAACCTAAG
        TTGCATTTAGTTTTCTGTTTTTGTTCAACTTCTGTTGAATACGCAGTTCCGACCTTTTGTCCGGAAATTCATAGTTAGGT
        TCTAATCGTAAGTTGCTTGTACGTGAGCGGAGTAAAGCAGAGGATCCTTCAGAGGTGCCTATACTACGGTTACTTAAACC
        GTCGCACTGATTGTAAGCTAGAGTTTAGATATAAGTTGGCAGGAGCTAGTTACTAAGGCCCCTTGCAAAATCTTTGGTTA
        GAAAAATGCTTTAACTATTTGAGAAATATAGGGAGTATTTTGGATGACACCTATTCATGTCGATGTACATAAATATGAGA
        TCAAAACAAAAAATCAATCGAAAGAATCGAAATTTATATGTAACATACATTAATTTTTGTGCCAGCTTTTGTACGCTTTA
        ACTAAACGAGTTAAGTCGCCCATTCTTTGACCCCCGAGGCTTTAGCCTCAACATAGAACATGTCCTTATATGTTTTGTTT
        GTATCTAGTGTTTAAGTGTAAACTTTGCAGACTTTGTGCAAGTAAATGCTGCCTTTTGTAAAATCCACGGAATTAGTTGC
        CTTAAGACAAAGTGTAAAGACAGGAGCCAACAGACAGGAGCCCGACTCCCTTCCTCCCCTTTTAGTAGCACATATTTTTG
        TATTTATAACCAGAGATATATAGAACTGGCAGTTGCGTATCTCGAGAAGTGCACTTGTGTCGGCTCTTTTGTTTTGTGTA
        AATAGCAAAGATGTTTATAGGCCGCTAACCATACATATATATAGTATATATATTATATATTATCGTTATAAGCGATTCTG
        TAAATACTATATATGTATCTTTATCTGTAACCGTTTAACTTATATCTTATCGTTCTTATCATGTAACCTTGTTTAAGCTA
        GAGTTAGATGACTAGCCTGTAAGAGCAACAAGTAAACTATATGAACTAGATGGATATGTATCTTTCAGTTTTTTTTCTGT
        TTCATTATTACTGCTCGCAGACCACAAGAACTAAAGTTTTGTATTAAAGCGGTTAGTTAATTTATTTAAAAATAATAAAA
        AATTATAATTAAACCC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0079086
        2846
        FBtr0079088
        3129
        FBtr0079087
        2885
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0078723
        509
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0078720
        563
        FBpp0078722
        531
        FBpp0078721
        575
        Comments
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG14026-RD
        Secondary FlyBase IDs
          References (2)