Open Close
General Information
Symbol
Dmel\LanB1-RA
Species
D. melanogaster
Annotation Symbol
CG7123-RA
FlyBase ID
FBtr0079490
Feature type
Associated gene
Evidence Rank
Length (nt)
6235
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 365 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TCATTCTCGCGAGTGGATCTCTCGAGAGCGGACGTTTTTCGAGTCGGAGCCGGGTCGAGTCGAGGGCCCCAACTTGGAAT
      TTTCTTTCCGATTGACTTGGAAAATAGCTTCTTCGTCGCGTGCGAGTGTGTGTGTGTGTATGTGTGTGCGCGCGGTGTGG
      AGTTTATAAAAAGAAGTCGAAAAGTGTTTGCCGCATCAACGAAAATAAAAACACCCAAGAAGAGTGTTTGTTGTTTTGTC
      TGTATAACAGAAAACTGATTTTCTCAACTTCACCTCTGCACATCGATCAAGGACTAGATATAGATGCATCATATGTAGCC
      GAATTAAAGTATCTGCTACAGGACTAGTTGGAAAATGCCACAATGAATAAATAAATATTTTGATCAAAATAAGGAAGAGA
      GCCGTGGTTAAATTTTCATACTGAGGATCACGTGGACAAGTGTAAGAGATCCCCTTAAAAAACGAACGAAAAGAAAAGCA
      ACTGATTAAAGTCCCGGCCGGAAGTGCCCCAGTGGAACGCGACCCCAACAACTGAGAGCCACATCGAGATGTTGGAGCTG
      CGGCTTATCGTGGTCATTGTGCTCGCCCTGCTCAGCTGGCAGTGGGACCCAGTGGACTCCCAAAGACCGCCCCAGCATGG
      CCGACGTGATCGTCCGAAATATCCACCGAACAAGTTTATCAAGACTCATCCATGCGAGAGATCCTCCTGCTACCCGGCAA
      CGGGTAATCTTCTGATCGGCCGAGAAAACCGCCTGACTGCCAGTTCCACGTGTGGTCTGCACTCGCCGGAGAGATTCTGC
      ATCCTGTCCCATTTGCAGGATAAGAAGTGTTTCCTCTGCGACACGCGTGAGGAGACCAAGCATGATCCGTACAAAAATCA
      TCGCATCGGACAGATTATATATAAAACTAAGCCAGGCACCAACATACCCACCTGGTGGCAGTCCGAGAATGGCAAGGAAA
      ATGCTACCATTCAACTGGATCTGGAGGCGGAGTTTCACTTTACCCATTTGATCATAACCTTCACCACCTTCCGACCAGCG
      GCCATGTACATCGAGAGATCCTTTGATTTCGGACAGACGTGGCACATCTACAGATATTTCGCCTACGACTGCAAGGAATC
      CTTTCCGGGAGTGCCCACTGTCTTGGAAAACATCACCGATGTCATGTGCACCTCGAGGTATTCCAACGTGGAGCCCTCGA
      GGAATGGTGAAGTGATATTTAGGGTGCTGCCACCGAACATCAACGTTACCGATCCCTATGCGGAGCACGTGCAGAATCAG
      CTGAAGATGACCAATCTGAGGATCCAGATGACGAAGCTGCACAAGCTGGGAGACAATCTTTTGGATAGCAGGCTGGAGAA
      CGAGGAGAAGTACTATTATGGCATCTCCAACATGGTGGTTCGCGGATCCTGCTCCTGCTATGGCCACGCCTCTCAGTGTC
      TACCGTTGGATCCCGCATTTTCCCAGGCGGACAACGAAGATGGCATGGTGCATGGCCGATGTGAGTGTACCCACAACACC
      AAGGGAATGAATTGTGAAGAGTGCGAGGATTTCTTCAACGATCTCCCATGGAAACCCGCTTTTGGAAAGAAAACGAATGC
      CTGTAAGAAATGTGAGTGCAACGATCACGCCGTTAGTTGTCACTTCGATGAGGCTGTCTTCACTGCATCCGGTTTCGTTT
      CCGGCGGAGTGTGCGACAATTGCTTGCACAATACTCGGGGTCAGCATTGCGAGGAGTGCATGCCGTACTTCTACCGCGAT
      CCAGAGCAGGATATAACGTCCGAAAGGGTTTGCCAGCCCTGTGACTGCGATCCTCAAGGTTCGTCGGACGACGGCATCTG
      TGACTCCCTAAATGAACTGGAGGAGGGAGCAGTAGCAGGTGCCTGCCATTGCAAGGCCTTTGTCACGGGACGTCGTTGTA
      ATCAGTGCAAGGATGGTTACTGGAATCTGCAGTCGGATAACCCCGAGGGCTGCGAGCCGTGCACCTGCAACCCCCTGGGT
      ACACTGAACAACTCCGGATGCGTTATGCGCACCGGCGAGTGCAAGTGTAAGAAATATGTGACGGGCAAGGACTGTAACCA
      GTGTATGCCGGAGACCTATGGTCTTTCGGAATCTCCGGAGGGTTGCTCTCTGTGTAACTGCGATGCTGGTGGATCCTACG
      ATAATTACTGCGATGTCATAAGTGGTCAGTGTCGCTGCAGGCCCCACATGACGGGTAGGTCATGTTCGCAGCCGAAGCAG
      AATTACTTCATTCCCCTGCTGCCCGAGGTTCATGAAGCAGAGGTGGTGGACGAGTGCATCTCGTATGGCGCCAACGGTAA
      CTGCAGCCTGGTGGCCGAAACTCCTGATGGCAGTTTCACGGGCATTGGTTTTACCAGGGTTCCTGAGAACTCGGAACTGG
      TTTTCACTGTCGGAGATATTCCTCGATCCATGCCATACGATGCGGTTATACGTTACCAGAGCACTTCACGAGGAGATTGG
      GAGAACGCCTTTATCACTCTTGTCAGACCCGATCAAGTGGATCCTGAAGGAGGATGCGGTGAACTAGCTGCAGCAACTTC
      TTCGGAAACCAGGATTCCGTTCTCCCTTCCTGATCGCAGCCGTCAGGTGGTTGCTTTGAATGAAGTATGCTTGGAAGCTG
      GAAAGGTTTATAAATTCCGGATTTACTTTGAGCGAAAGCGACACGATGTGGACAGTCCCACAGCGACGATCTTGGTGGAT
      TCTCTTACGCTCATTCCCCGCATCGATGTAACGCCCATCTTCCAAGGATCCGTTCTGGCTGATATTCGCAAAAAGGATTA
      CGAAAAATACAATTGCAAATCCTCTTTGTACGATATGAACTACAAGTCGGATCCTAAATGTCAAAATCTGGACAATATCC
      TCAGTGTGTTTGTCCACGATGGAGCCAGTATGTGTAATTGCAATCCAACCGGATCGCTGAGCAAGGTGTGCGAATCCAAT
      GGAGGTTACTGCCAATGTAAGCCCAATGTGGTGGGCAGGCAGTGCGATCAGTGTGCTCCGGGCACCTATGGTTTTGGTCC
      CGAAGGTTGCAAGGCTTGCGATTGCAACAGCATCGGATCGAAGGATAAATACTGCGACCTGATAACCGGCCAGTGCCAGT
      GTGTGCCGAATACATACGGCAGGGAGTGTAATCAGTGCCAGCCGGGCTATTGGAATTTCCCCGAGTGCAGAGTGTGCCAG
      TGCAATGGTCATGCGGCCACGTGTGATCCCATTCAAGGAACCTGTATAGATTGTCAGGACTCGACCACGGGCTATAGCTG
      TGACAGCTGTTTAGATGGATATTATGGAAACCCACTTTTCGGCAGTGAGATCGGATGCCGACCATGCCGCTGCCCGGAGA
      CGGTAGCCAGTGGCCTGGCGCACGCAGATGGCTGCTCCCTGGACACACGGAACAATAACATGTTGTGCCACTGCCAGGAG
      GGATATTCCGGCTCCCGTTGCGAGATCTGTGCGGACAACTTCTTTGGCAATCCGGACAACGGTGGTACCTGCTCCAAGTG
      CGAGTGCAGCAACAATGTCGATCTTTATGACACTGGAAACTGTGATCGGCAGACGGGAGCTTGTCTAAAGTGCTTGTATC
      AGACGACTGGCGATCACTGCGAGCTCTGCAAGGATGGATTCTTTGGGGATGCACTGCAGCAGAATTGCCAGCAGTGCGAA
      TGCGATTTCCTCGGAACGAATAATACCATAGCTCATTGCGATCGTTTTACGGGTCAGTGCCCCTGCTTGCCGAATGTCCA
      GGGTGTGCGTTGTGATCAGTGTGCCGAGAACCACTGGAAGATTGCCTCTGGCGAGGGTTGTGAAAGCTGCAACTGCGATC
      CAATTGGAGCACTCCATGAACAGTGTAATTCCTACACGGGGCAATGCCAATGCAAGCCAGGATTTGGCGGCAGAGCGTGT
      AATCAGTGCCAGGCTCATTACTGGGGCAATCCCAACGAGAAGTGCCAGCCGTGCGAGTGCGATCAGTTTGGAGCTGCTGA
      CTTCCAGTGCGACCGGGAGACGGGTAATTGCGTCTGTCACGAGGGAATTGGGGGCTACAAGTGCAACGAGTGCGCCAGGG
      GCTATATTGGGCAGTTTCCACACTGCTCACCTTGTGGCGAATGCTTCAACAACTGGGATTTGATTTTGAGTGCTCTGGAG
      GATGCCACAACTGCCACTATCCTACGAGCCAAGGAAATCAAGCAAGTGGGAGCGACAGGAGCCTACACGTCCGAGTTCAG
      TGAACTGGATAAGAAATTGCAGCACATTAGGAATCTGCTGCAGAACACCTCGGTCAGTCTGGTTGATATAGAGAAACTGG
      ACTATGAAACCCAATCACTTAGGGACCAACTTCAGGCGTCCCATGGCCGATTAAGTGAAACCGAGCAAAACCTGGATGAC
      ATTTACAATTCGCTAAGTTTGTCGGGCGTTGAGCTAGAGAGCCTACAAAATCACTCCAGATTGGTGCAACAACTGTCCAA
      GGAACTGAAGGAAAACGGCATACAACTGCAGGAGTCAAATATCGAGGGAGCTTTGAACCTCACACGTCACGCCTACGAAA
      GAGTCAGCAATTTGTCGACCCTTAAAGACGAGGCCAATGAACTTGCATCGAACACCGATAGGAATTGCAAGAGAGTGGAA
      AATCTGTCTAATAAGATTCAGGCCGAAGCCGATGACCTGGCAAACAATAACAAGCTCATTGAAGACTACCGAGCAGAGTT
      GACTTCGCTAACCTCCCAAATTCCCGAGCTGAACAATCAGGTTTGCGGCAAGCCAGGTGATCCCTGTGATAGTTTGTGCG
      GAGGTGCTGGCTGCGGTCATTGTGGCGGTTTCCTGTCCTGCGAACATGGCGCCAAAACCCATTCGGAGGAAGCCCTTAAG
      GTGGCCAAGGATGCTGAGACGGCCATTACCAGCAAGAAGGATCAGGCGGACCAAACCATCAGGGCTCTGACCCAGGCCAA
      ACTGAATGCCTCCGAGGCATATGAGAAGGCCAAGAGGGGTTTCGAACAATCCGAGCGTTATCTGAACCAAACCAATGCCA
      ATATCAAGCTGGCCGAAAACCTATTCATAGCCCTCAACAATTTCCAGGAGAACAAGACAGCTTCTCCTTCGGAGAGCAAA
      GAACTGGCACAGAAAACTCTCGACTTGGACCTGAAACTGGAACCCGAAGAGATTGAGACCCTCGGCGACCAAATCAACAG
      GGCTGTCTCATCGCTAAAGAATGTTGAAGCCATAATCTACAGGACCAAACCCGATTTGGACAGGGTCAATAATCTGCAGA
      GCATTGCCAATGCCACCAAGGAGAAGGCCGATAAGATCCTGGACTCTGCCAATTCGGTCGTGGAGAGCCTGGCGGCGGCA
      GATGAATCCCAGGGTAAAGCCAAGGATGCCATTCAGCAGGCGAACAGTAACATTGAGTTGGCCGGTCAGGATCTGGAGAA
      GATCGATGAGGAAACGTATTCCGCCGAAGCTCCGGCCAATAACACAGCACAGCAGGTTGAGAAATTGGCCAAGAAAGTGC
      AGAAACTGCAGAATAACATAATGAAGAACGATCGGGATGCCAAGGAGATAACCAAGGAAGCGGGTAGCGTCAAACTGGAG
      GCCATGAGGGCTCGCGGAGAGGCCAATAATCTTCAGTCTGCCACAAGTGCCACCAATCAGACCCTCACCGATCGCGCCAG
      TCGCTCCGAAAATGCCAGGGAAAGGGCCAAGCAGCTGCTCCAGAGGGCCTCCAAACTAACAGTCGATACGAACGCCAAGC
      TAAAGGATCTGAACGATCTGCAGACCGTCTATCTGAACAAGAACCAACAACTACTGCGATTGCAGGCCGAGATCGGCCCC
      TTGAACAAGGAGCTCAACGAGCACCTGATTCACATCAAGGAGCGGGGGTCGCACTACAGGCAGTGCTATACGTAGATTGG
      GAAACATCCATTTGCGTGGCCATCTAAATTGCCATATTCATGAACAAATAAGCAAATTGCGAAATACGAGAATCAAGTAA
      AGAACTACAAGAACAACTAGGAAGGCGACAGTTATTATGTAACCACTGTTAAGTTACCGTTACGTTTTGTACTCTAAGCG
      AAAACCAACACTGCAATGTTAATTTTAAAAATTGAGCGAAAGAAATCGATGCCTTCACTTTTAATGTGTACACACTGAGC
      TAAGTTTTTCTTATACTATCCCTATACCATTTTGTAATGCAATTAATGTAATTAAATAAAACTACTTAAATGTGG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0079491
      5947
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0079113
      1788
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0079114
      1788
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      transcription start mapped by primer extension and SI nuclease protection.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      LanB1-RA
      Secondary FlyBase IDs
        References (3)