Open Close
General Information
Symbol
Dmel\CG32982-RA
Species
D. melanogaster
Annotation Symbol
CG32982-RA
FlyBase ID
FBtr0079771
Feature type
Associated gene
Evidence Rank
Length (nt)
2761
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 114 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CCAGTCATCGACGGGCAGCTCGCGTGGATAGTTCGCCTTCGCTTCGGTCGCTCGTTTGCTTTGCGCGACCAACTCACTTT
      GAAAATAAAATTTTGGCCAATAACAAAATTGGTTTTTTCAATTTGCTAAGCCACAGCCGCACCGAGAAACCGCAAAGAAA
      TGCGACGCGACACGCTGCCAACAAATTAAATTTAACCTAAAGAATCAACTCGAAAAGTGCAACATTCCCCATAAATAATA
      AGCAAGCGTTGCAGTTAACTTACCGCTAAAATCAACGATCCAACAATCAAGCAAAAAAAAAAACAAAAGAAAAACCATCA
      ACGTAGGCTAAGAAACAGAACGGAAAATGCTCATGCACACAACATCAATTTCCACAACGTCGACGGCCACCATGACCAAC
      TCATCGTCCTCCGCCACGCCCACACCCGGGTCGACTTCCTCCAACAACAGTGCCACGCTCGACGCGCTGCACCAGCAACA
      ACAGCAGCAGCACCAGCAGCATCAGCTGCAGCAACAACTGCAGCAGTTGCACACGAACGCCGCAAACAATTCACGGCCCC
      CCTCACGTGCCCCCTCCATTCTGGACAGTCCGACCCTGGCGCGTGTGGAGCGGGCTCGTCTGCGACTGGAGCAGCAGGAG
      CGGGAGCGGGAACGGGAGCGTAGCAGCCAGCGGGAGGTGGGCGGCGGCAGCGGAGGAGGCGGCGGCGGTGGTAGCAGCAC
      TGGCACTGGCAGCACCGCCACAACCATGAATCGTGAGGATAGCCTGGAGCGCAGTATTTTGGATCCCAAGCAATCCTTGC
      TGGCAGGACGCATTCCGGTGGCCTCCATGACAGGACCCATTAAACGCGGACTGCTCTGGCAGCAAAGGGATCGGCTCTTC
      TCTCGCTGGAAGGAGCGATACTTTGTGCTCACTCGTGACTACTTGCACTGCTTCAAAAGAGCCTCGGGATCGGCCAATGA
      ACGTGCCTCGGATATGGGACAGTTTATCTTCAAGGTCAAGCTGGTGGACGTGGAGAAGGTGGAGTGGCTGAATCGGCGCT
      CCTACAGCGCCATTGGTCTGCTACTGGGTCGCGAGGGTCGTGTTCTACTCCGCTGCGATGATGGCCTCGAGGATTGGTTC
      GAGCTGCTGGAGGAATGCACAATGACCTCCAAGGAGCGCAGACGAGCCCTGAAGATTGCCCAAGGACCCAGATCCCGAGC
      CTCATTGGCTGCTCCCGTTTCGCATGCTTCGCTGCAGTTCCAGCATTTTGGACTCGGAGGCACTTACTCGAGTGCCCTGG
      ACGATTGGCTGATGACGAATGGAACCGGTGGTCTGGCCCGGCACAAGATTGGAGCTGGCAGTCTGAACGGTTATGGCGGG
      GCCAATCCCTTCCTGTTCTCCGATTCGGTGCCGGATCTGAGTGCCCTGAACAACGAAAACCACAATCATCACCTGAGCGG
      CATCAGCACGAACCACTCGACGCCGCAAAAGATACCGCACCACAGCAATGCGAATCTCAGTCGATACTCCAATGGATATG
      TCTCGGCCCAGAACAGTTTCACCCAAGCCGGAGCACTCTACGGATCGCCTAGGCGGATCTTTATCAACAGCAGCTTCGGT
      TCCAATCAGGTGGTGGATGAGGAGACCGAGGAGACGGAGGTTCAGCTGAGGAGACCCAGACTGTTCCGGGGAGTTAGCGC
      TACTCCGGATAATGGCAACGAACTGGACCGCGATTGGCTGTACCGGAAGCCAAGGGCGCCCACTGATATGAGGCACTCAG
      TTCAACCAATGTTACCCACTGGCGGCGGCAGCAACATCGGGCTGGCCAAAACCGAACTGGACTGTTCGGCCCATGATAGT
      GGCCTGGACACGCCCCCATCGACGCACCGCCCCTCGAGCTACCGGGAGGCGAGCAGGGACAGCACAGAGACCAATGGCAG
      TTCGTCGAGGGGAACACTGCTGAATAACTCATCGCCAGGCGGCAGTTTTCGAGCCAAAAAGCTGAGCACCCAAGATCAAC
      GCATCTTGAAGATGCGCAACAACGAGGAGGATCGCTGTGCCTCCATCAAGATGGCCAATCGTCTCAATCAGAATCAGGAG
      CAGGCCACTTACGATCCCAACCAGAATCGCTACTATAAGAACGGTAATGCCACGCCCCCCACATCACTGACGCCACAGCA
      TACGCCGCAGCACAAACTGACGATGATGCACTATGGCAATGGGAATGGGAACATGGGCACCCTGAATGGCAACACCAACG
      GATCGGATCGCATAAACGGATCGGCCATTTTCCGGGAGCGCTACCAACATCCCGCCCTGGCCGCCATCATCAACGAAGCC
      CAGGGCCTTAAGTTTCGAGAGCGGGCCTATTCGGACAGTCAGCAGCGTCGCCTCAACAACAACAATGGACCGACTCCCCA
      ACCAGCCTCGCCACTCGCCCAGCGCCGGAATAATGGTGGACTCGGATCCGGAGTCGGATCGGGGGCTATATATGGCACGC
      CCACGCGTGTATAGCGCCTAAAGGTCTAAAGATAATCCAAATCGATGGAGAATTGATTGCTCCCCCACTAGTTTAATAAT
      GATATAAATTAGTCGGTAAATTAGTCGACTTGATACAAAGTTTTGGAAATTATTTGCATAGAAAATACTTCAACGAAGGT
      AGAGAATAGTAACTAAATCTTAACTATGTAGTAGTACTCGTAGTGTGTGTGCTCCAATGTCCAGCTTTATGTAAATGTTT
      AAATAAAATATACATTAGTAAAAAGCATCTTAATAAAAGAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0110960
      2426
      FBtr0301039
      3241
      FBtr0301040
      3397
      FBtr0303888
      2931
      FBtr0330218
      2766
      FBtr0330219
      2682
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0079372
      715
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0110260
      550
      FBpp0290261
      778
      FBpp0290262
      793
      FBpp0292891
      730
      FBpp0303251
      720
      FBpp0303252
      687
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG32982-RA
      Secondary FlyBase IDs
        References (2)