Open Close
General Information
Symbol
Dmel\DIP-ζ-RB
Species
D. melanogaster
Annotation Symbol
CG31708-RB
FlyBase ID
FBtr0079776
Feature type
Associated gene
Evidence Rank
Length (nt)
3562
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 23 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TCAGTTTCGCTACGGATTCTGCACGAAGCGGACGCGTTTTATCGGTGTTACACTGAAAGATCCCCGGCAAAGGGAAAGTC
          GTACTCAAGTGTCATGTGATCGATGCCAAATTAGAAGCACCTGACTCAATGTGATCGTGTTGAGAAATGACTTAAAAGTC
          GAGCTAAAAAACTTAGGTCCACTTGATTATAAAATTTAAAAAAATACCAAAACTTGTAAGCGTTTTATTGAAAGATTACA
          ATTTGTAAAAGTGGTTGAAAACTTGGTATATCATACGTAACACAAAACTAACCTACAGAATTAAATATTCACAAAAATAT
          TCTTGTAGTTACAGTGTGGTAAAAACTATTTAAAAATACATATGCAAGAGGGCTTTTCAAAATAATTTTTACCAAAATGG
          CGTTGCTTACAAACAGAACATATTAAGTAAATGCCAGAAGGAAATAATCCTGTGAAAAAAATCTAAAAATTTGGTAATTG
          CCACAAGCCAAAAACTGCGATAACAAAACCGTGTGAAAAACTTCGTACAAAAGCGAAAACACAAACAAACCCCGCGGCGT
          TTTAAAAACCAGTCGGCGGCAGTGAGGTGGTAAAAACTGAGCGAGTAGATCCGAGAGAATGCACTTTGGCCAGGAGGCGA
          GGCCATCATTGGGGCTCCTGGCTGTGGCTGAGTCGACCGCAACGGCAAGTTGATGTTGCCCCCGTCCTGGCATCTAATTG
          GGGCCCTCCTAGTGCTCGCGGCAACAGCGGGGGACTCCACCAACAAGATCATCTTGCCGCAGATTCTAAACGGTGGCGGT
          GGCGGCGGGGGCGTCGGAACTGCCCAGGGCAAACATCCGTCTGGATCCAAGACGGTGGCAACTGGAGTGGTTCCAAACTT
          CGGTGGAGCAGCTGGCAATGGAGCGGGCGGAGGAGGACCTGTGGCTGGCAGCGGAACCGGAAGCACCGTGGTCGGCAGCA
          ATGGCGTGATTGTGGCCGGAGGCGGGGCCAATGTGCCGACCTCGAATTTAAACATTGTCGTCGAAGAACCCGAATTTACT
          GAATACATCGAAAACGTAACTGTACCTGCTGGACGTAATGTTAAACTCGGTTGCTCCGTGAAAAATCTGGGCTCATATAA
          GGTCGCCTGGATGCACTTCGAGCAGTCCGCCATCCTGACCGTTCACAATCACGTGATCACGCGCAATCCGCGCATCAGTG
          TCACGCACGACAAGCACGACAGGCACCGCACGTGGTATTTGCACATAAACAATGTGCACGAGGAGGACCGGGGTCGATAT
          ATGTGCCAGATCAATACGGTGACGGCCAAAACGCAGTTTGGCTACCTAAACGTTGTCGTTCCCCCCAACATCGACGACTC
          ACTGAGCTCCAGCGATGTGATTGTGCGAGAGGGAGCCAACATTTCGCTGAGATGCCGGGCCAGCGGTAGTCCCAGACCCA
          TTATCAAATGGAAACGCGACGATAACTCCCGCATAGCCATCAATAAGAATCACATAGTGAACGAATGGGAGGGCGACACT
          CTCGAGATAACTCGCATTTCCCGACTGGACATGGGCGCCTATCTGTGCATCGCCTCCAATGGGGTTCCACCCACGGTTTC
          CAAGCGCATCAAAGTCAGCGTGGACTTTCCTCCAATGCTGCTTATACCCCATCAGTTGGTTGGTGCTCCCGAAGGTTTCA
          ACGTCACCATCGAATGCTTCACAGAGGCACATCCCACTTCTCTGAACTATTGGACACGTGGCGAGGGACCAATCATACAC
          GATTCGCACAAGTACAAAGTGGAAGCCACAGTCGGATTGCCAGCTTATAAAACCCATATGAAGTTGACCATCATCAATGT
          GAGCAGTGGCGATGATGGTATTTACAAATGTGTGGCCAAGAATCCGAGAGGGGAAACGGATGGCATCATACGACTGTACG
          TTTCATATCCTCCAACCACTGCCTCATCGGGTATATACTCCACGGATACGCATTGGGGGGAAAATGGGATCAACAATAAT
          TATGCTTATGGTGGCCCCGACTCCACGCGATCGATTTATGCGCAGGATAAAAATACGCGATATCAATCGAATTTGAACGA
          AATCGGCTTATCTGAACAAAAATCCTTCCTAGATAAGACGCAGAATCCGTTGTTGGCCAATGGCAACGCCAACGAGGCGG
          ATGCGGAATCCAACGGGGCCCGGGGTCACAACCCTTCGATGGCCATTGCGTGGCTGTTCGTCGTCATCGCGACACTGTTG
          TTAACAATCCGATCTGCGGTTGGTTCTAGCCATAGCCTAAGTCTATGTTAGTTAACGCAAATCTAGCTTATAGTTATCAG
          ATTCAACTACGTATGGGACTAGCTGTAAGGCTTTACGAAACACGTAATGTTAGCGAATGGCATTAGCGTATGTATGATGT
          ATGTGTAATAAACTAGACCCTAGTATAAGAGACCCTAATTACAATCCGCCCTTTCCCCTTATACATCACAAGGTATATAC
          ATATATATATATATATACATATTATATATATGAGAGACCAGGTCCGACTGAGCTCGTTAAGCATATGTATAGCCATCAGC
          CATCAGTCATCAATCACAAGCCCTTTCTCGGGGGTCTATATACACTCATATTCGAATCTATTACTAGAAGGTAAGATGAA
          CCAACCAAAGGGTAAATGCAATTTCATTTTGCTTTCAATGCTGTGCTTCAAACTGAGAAAGTTTCATAGTTATCATATAA
          TCTACCACGGTCTATACTTATAGCTATGCATACACATCTACATATATAGTCGTGCGTTAAACGCTGCTAACACTTGCATA
          TAAGATTACAGACACTTAATATATTATTATGCATATGCCTTAAGGATTGCAAGCTGAAATGCAAATTAAACTAAGAAAAA
          TAAGCCATCACACATATCGATCGTGGAAATTGTTTAATTAGGCCAGATATACCGAATCACGTATAGAGTTTTGTAGATAT
          AGGTAATTAACCTTTGAGGACAAATTTCGAATGAATTTATTTATTTTAAGTTATCAATTTTAGCAGATGAATTATTTGAA
          AATCCCAAATTCAGTAAATAGAATCAAACAATTAGATGGAGTGTTAACTAATAATGTTAAAATATAGATATTATTTCCTG
          TTTATCATTAATTTATATAATATGGTCCACAAAGTATTTACACCCAGTCTCATCGAATAAAATCTTGTTTGTTTATTAAA
          TAGCAACAACCTAATTACGATGTAGCTAATAACAGAATAATTAATGTACTAATGTAAAGACAACACGAAATGTTAAACAT
          TTAAGCTAAAATAAAGCAAATTTAAATTGTGTTGCTTTAAAGACAAATTTAATTAGAAAGCAAGAAAGCATGTTGAATGT
          TGAGAAATATAATTGAATTGAACGCAGAGCTATGGACACAATGGAAAAAGGATATACAAATATATTACATTATATACAAT
          TATAGACTACGTATATACAAAGAAACACACGCATACACGAACTACACTTATGTAACATGTATTTAAGCGTATAAAATGAG
          TTGTAACTGAGGCATTAAATTAAATAAAAATCCCAAAAAGAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0079777
          3444
          FBtr0303881
          3384
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0079377
          532
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0079378
          532
          FBpp0292884
          512
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG31708-RB
          DIP-ζ-RB
          Secondary FlyBase IDs
            References (2)