Open Close
General Information
Symbol
Dmel\Dref-RA
Species
D. melanogaster
Annotation Symbol
CG5838-RA
FlyBase ID
FBtr0079889
Feature type
Associated gene
Evidence Rank
Length (nt)
2872
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 94 )
Sequence
ATCAGTGTTAGCGAGAATACTCAACAAATCGCATTTTTTACGACAGTCAGACGTATTGAAATTAAAAAGCGGTGACTCTC
ATATTTGAGCAGTCTGTAAAAATAATCTCAAATAAATGAGAGTGCATTTGAAGCATTTAGCAACGTTTTATTGCCTTATC
GATTGACGGCGTGTCGCGTGGCAACTCTGAACTGTACTTCTGATACAGATAAAAAACTATTGACTATTGAACCGTCTATC
TATAATCGAGAAATTGCGCGCTAATACACGCATTGGGCACAGCAATCGTTGTCGAATCTAATTCAAAACAAACAAGAAGA
TCCCAATCCCCCACAGAAGACAAGATGAGCGAAGGGGTACCAGCGTCGCCCGTGGCCATTGGCGAACTCAAGTACGAGGA
TGTGTCGCAGCTAAATTTTTCCAAACTGTACTCGCCCAAGATGAAAAGCGTATACTGGCGCTACTTTGGATTCCCCTCGA
ACGACAATAATGAGGTGATTACCAAACAGAATGTGGTCTGCATTAAGTGTCACAAGGTGCTGACCAACCATGGCAACACC
ACCAATTTGCGTGCGCATCTCCAGCACCGACACAAGGATCTGTTCAAGGAGCTGTGCCAGGAGCACGACATCCATGTGCC
GCCGCGCAAGACGCCGCGTAATGTATCCCATCCACCGCTGTCCAAGCGGAATGTTTCCTCGCGGCGGGTCAAACTGGAGT
TCATTAATAACCGGAACCACGATAACGCTTCCGATGATGAACTGGACGAAGCAGCCGTGGCAACTGCGGCCATGCAGGCG
GAGGAGGACGCCTCCTCGCAAACCATGCTGTACGAGACCATGGTGCCCTTCACCTACGACGAGGCCGAAAATCTGGTAGA
GGAGGAGGAGCGCCTAGTTATGGAACCAAAGTACGGACGCAAACGCAAAGTGGCCACTCCATCGAGTGCCCTGATGCACG
GGCGTGTCATCAAGCACGAGGAAGGCGGCTATGCCGCCGTGGCGAACATCGCCAATCTGGCCGAAGCCCTTACGGACATT
GTGATTAAGGATTTGCGCAATGTGGATTCTCTGTACGATGCCGGTTTTGGTGAATTCCTGCGTCAAGTCCTAGGCAATTC
GGCAGCCATGCCCGAGCCACACAAGATCGACTCTTTGATCAATGAGATGCACGCCTCCAAGTTTCTGGAGATTGGCGAAA
TCACGCGCGATTTCACCTCCGAGAAGCCCTTCTCTCTCGCCTTTGAGATGTGGGTGAATGTTGAACAGCGGCGCTTCCTT
AGCATCTTCCATCACTTTCTGGACGAGGAGACGCACTCAGTTCGCGGTATGCTGTATGCCACCGTGGAGTACAACGACTA
CATCGTCTTTGACGATCTGCTGACCGACTTCTATTTGGCCAATTGCACACTGGCCATCATAAACTACGACGAGGAAGAGG
ACCTTTTGCACACCTATCTGCGAGAGAAAAATATACCCATTTCGCTGTGCTACGTTTCGGTAATTGACAAATGTTTGCGT
CGTGTGTTTGAGATCGAAGAGGTGGCCACTTTATTGGAGCAGGTGAAGGACCTAATGCAGCGTCATTCAACGGAGATTGC
CTCCAAGGTGTCCGAGGTGCCCATGCCCACGTACAACGAGCACTTCCCCTGGACACTGTACGAAACATTGAAGTTCTTTG
CCGAGTCCATATCTTGGTCCGAGGACATGGATCACCTGGTTATATCAGCCAAGACGGTGACGGAGGCCCTGAGTGCTCTG
GTGATTGCTTTGGACACGCTGCGTGGCGAAGACATTCCCTTGTGTAGCATGCTTTCGCCAATCACTTCAAAGATTCTTAT
CAAGAAGTTGGGCATCGCCGAGCAGGACGATCCCCTAATGATGAATTTGAAGCGGACCATTTCCAGTGTCCTCCAGGCGC
ACGTTATATCCAATGACAATCTGACCGCTGCTGCATTGTTGGACCCACGCTTCCACCGCCTGACCACCATTGACAACCTA
GAGCGAACCGTTCGTATGCTGACCCATAAGTATAACATTAACTTTGGTGGAGTGGGCGAAGGGGAATCCAACGAAGTGGC
AGCTACCTCCAGCGTGGTGGCCATTAAGTCAGAACCAAGAGTAGTGGACGGCAGTGCACCAAAGAAGTTGGGTCTGAAAC
TGCTGTTTGACAGTAACGAGATACCAAATCCTCCGAAGCGAGATGCGGACAGCAGCGTGGAGTCCGATCTTAAGCGATAT
CGCAACGAGGTGGTCGTTCAGCTGGATGAGTCGCCCATCGAGTGGTGGCTCAAGATGGGACACATTTATGGAACGCTCCG
CGATTTGGCCAGCCTGTACCATAGTGTGCCCGGCGTGGTGACGCTCAGCTTCAAGAAGGCGCTGAGAGACCAAATATACG
ACTTCAACAAGCGATTCATGCTCACCGGTAGTCACATCGACGCCATCCTCTTTCTTCATCATCACAACAATTAGTCTGCA
CTGGCGACTACTGTTTCTTATAATGCAAATACTTTTTAATTACTTTTAACGTAATCCGATCTTGTGTATATGAAAATGAC
TACCAGGGGCGAGGCAAATAGTAATAGCGATTCCGCAGTACTTTTAACCAAAAGACAGCCTTGGGACGTACACGGAACAT
CTTAAGTTATCGACGTATAAATGTTAAGGGAACATTTTGACATCATATATTCAAATCAAACAGATAATCTAAGAATATTT
GTTTAATAAATCCATAACGAAAAAATATCACGCTTATCAAGCTCACTTGTAAATCCCCTTATATCCATTTCAAGAGAACT
AATTAAATACTTAACTTAGTTGTACATAATTGATATTTTAATCTTATAAATAAATAAAATGCATCTAACTTT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0310483
2739
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0079485
709
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0302627
709
Comments

Extended 3' UTR based on RNA-Seq and/or EST data.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG5838-RA
Secondary FlyBase IDs
    References (2)