Open Close
General Information
Symbol
Dmel\NimC2-RB
Species
D. melanogaster
Annotation Symbol
CG18146-RB
FlyBase ID
FBtr0080589
Feature type
Associated gene
Evidence Rank
Length (nt)
2502
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 3 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TGATCATTTGTCGAGCGTAACTTAAACCGAACAGTTGATCAAAGACGTTTAATCGAGGATCATAATAGGATTTTAAAATT
          TAAAATGCTTCTTCTCTTCTTGGTTTTACTGAGCGGCCTTCAGGTGCAGGGCTGTGTCAAACAAGCTCAGGTGGTTAAAA
          TGCGCGGTACTTTGGTAACAATGCGTAAGCACCAGAACTCAGCAAATTGCACCACAAATTGTGGACCCCTGGTGGGAAGA
          ACCAGAACTGAGACTTACTTGGGCTTTACGGATGTTTGCTGTGACGGCTATATACGCGATGAAAATAACGAGTGTGTGCC
          GCTGTGCAATGATTGTGGAGCCTCGGGAAAATGCCTTTTGCCCAATGTGTGTTTGTGTGGAAAGGGTTATGTAAGTCGTA
          AGGATCACGGTCACTGTGAGCCGGAGTGCAGTGAGTCCTGCGTGAACGGAAAATGTGTGGCACCGGATGAGTGTGAATGC
          CTTGCTGGCCATCGTTTCGTGAATGGCTCTCAAACGGCATGTGAGCCAATTTGTGTGGAGGACTGTGCCAATGGTCGTTG
          TCTGGAGACGGGAAAATGCCTGTGCAACAATGGCTATCAGCGGGATGAAAAGCTTAAGAAATGTGTGCCCATCTGCCAGG
          ATGCCTGCTATCATGGCGACTGTGTGGCGCCCAACGAGTGTCGCTGTCATCCCGGTCATGAGCAGCGCTTGGGAGTGCCG
          TGGATTTGCGATCCGATCTGCTCGAGCGGCTGCGCCAATGGCTATTGCCAGGGTGCCGAGGTGTGCGCCTGCAAGATGGG
          CTATGCCCACAAGGATAACACCCTTGCCTCAGGCTGTGAGCCTGTGTGCAATCCACCCTGCACGAATGGCACTTGCATCT
          CACCCGGCCACTGCGCCTGCTCCGAAGGTCACGTATTTGCCGAGGGATCGCGTCACGAGTGTGTTCCCAGCTGCCGTTCC
          GGTTGCGAGAATGGATATTGTAGTTCTCCTGGCCGCTGTGAGTGCCACGAGGGATTCGAGAAGACATCGCCGCACCGCTG
          TTCACCCACATGCCGACCGGGCTGTGGCCAGAACTCCCGCTGCGCCGCTCCAGACACCTGTGCCTGCGATGTCGGCTACG
          TCTTTGTCAACGGCAGCACCACCGAATGCGAGCCCTTCTGTCCCAGGAACTGCCGGAATGGAATCTGCAGTAGTCCAGGT
          GTCTGCACATGCTTGGAAGGTTTTCAGGCCCTTCTCTCGTTCTACTGCATACCAGTTTGCTCGAAAACCTGCATTCATGG
          CAGTTGTGTGGCGCCCAACGAGTGTCGCTGCTTCACCGGCTACCGACCAAATCCCAGTCTGGGAGCGAATGTCTGCGAGC
          CCATCTGCAGCCAGGGATGTGTTCATGGATTTTGCATCGCCCCAGAGATCTGTCAATGTGATCTGGGCTTTATCAAACGA
          TGGGCCACTGGGACCTGTGAGCCGCACTGCCCACAGAAGTGCGTGAACAGCCATTGCTTGGGATCGGGAGTGTGTCGCTG
          CTACGAGGGATACAAGCTGAGGCCGGGATCAACGTCCATCTGTGATCCGGAGTGCCAGCCAGGATGCAGGAATGGAACGT
          GCGTAGAGCCCAACAGCTGTGCCTGCTTCGCTGGCTACGAAGACACCAAGGTGCCGTACGAGTGTGTACCCTCCTGCCGT
          CCGAGATGCGAGAATGGGCGATGCTCCTCTCCGGGACACTGTGAATGCGATCCCGGCCATGTGGTTACCAACTCCAGTGA
          ACCGAACTCATGTCGTCCCCAGTGCCAGGAGCAGTGCATTAATGCCGAGTGCGTTGCGCCGGAGAAGTGCGCCTGCCTAC
          CTCGTTACCGATTTTTGCCCGACAGCAGCACCGAATGCGAACCGATTTGCTCGAAAGGATGCCTTTCTGGGCAGGAATGC
          GTGGCACCAGACACCTGTGCGGGCTTTGAATCCCTAATAAGTCCGACCACTGGCAAACACCTGGCATTCCATTGGTCCAT
          GTTTGTCCTGGCAATTTTACTCTGCCTGGCTCTGGTAATGATTCCCCTGTTGGTGCTCCGGGAAATGCAGCGACGTCGTC
          GTAATGGCGACAAGCAAAGTTCCCGGCTAATCGAGAATCCTTCCTATGGAGTTGTGCAGGCAAACAGCGAAGATACGAAC
          AGCGAGTTGGGCATTGGATTGGGGGATTAACCAAATTTATTTTAGAGACACCCGATAACCAGATAGATCTATTTTTTTTA
          AAACCCCTAGGTCAAATAGGAACTTTCGAATGGTTAAGGCAGGAAAATGTTTGTCTGTGGAAATATTTTAATTTCAATTT
          TTATGGCTTGGTTTCCTTTACAATCTTCTCGTTCGATTAAGTTTTACACTGAAGGATGCTTGGCATCGAAAATAATACAC
          ACGTATATAAATATATATATATATATATATATAGTTAAGCTAAACATTTATGGTTTAAAGTTAAAAACATAATCTACCGT
          AATAAATTAGGTAATACTTAAT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0080588
          2343
          FBtr0343689
          2819
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0080166
          701
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0080165
          648
          FBpp0310277
          701
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (3)
          Reported As
          Symbol Synonym
          CG18146-RB
          NimC2-RB
          nimC2-RB
          Secondary FlyBase IDs
            References (2)