Transcript Dmel\CG4440-RA

General Information
Symbol	Dmel\CG4440-RA	Species	D. melanogaster
Annotation Symbol	CG4440-RA	FlyBase ID	FBtr0080835
Feature type	mRNA	Associated gene	Dmel\CG4440

Evidence Rank	Strongly Supported	Length (nt)	384
Evidence Score	15

Map ( GBrowse )
Recent Updates
Description	What does this section display? This section contains items that were added to this record for each release. It currently only tracks new links between this FlyBase report and other FlyBase data classes (e.g. genes, references, stocks) or controlled vocabulary terms (e.g. GO, anatomy terms). What does this section not display? This section does not currently display links that were removed or gene model changes.
Update Feed	Click the icon below to subscribe to this FlyBase record and receive updates automatically through your feed reader.
FB2013_03
FB2013_02
All updates	Click here to see a list of all updates to this record from FB2010_08 and on.
cDNA Clones Consistent with the Transcript ( 74 )
cDNA Clones, Fully Sequenced
Exact Match
Contained within the annotated transcript, internally consistent	RE16123
End(s) extend beyond the annotated transcript, internally consistent
cDNA Clones, End Sequence Only (ESTs)
Contained within the annotated transcript, internally consistent	Diego_25_G07 RP003002373 RP003008976 RP003013486 RP003025066 RP003031726 RP003083915 RP003098375 RP003101470 RP003109448 RP003113952 RP003137925 RP003140854 RP003142405 RP003143800 RP003158611 RP003169230 RP003178012 RP003194990 RP003196836 RP003199786 RP003202937 RP003203614 RP003205319 RP003208203 RP003213900 RP003215957 RP003223023 RP003227764 RP003234539 RP003240414 RP003240518 RP003240899 RP003241570 RP003248256 RP003259171 RP003268080 RP003274707 RP003292475 RP003308925 RP003312188 RP003327656 RP003330652 RP003332333 RP003349193 RP003350933 RP003356255 RP003360115 RP003372601 RP003390824 RP003396034 RP003404807 RP003424260 RP003438644 RP003448065 RP003451573 RP003455904 RP003465901 RP003478603 RP003505290 RP003529992 RP003560741 RP003566810 RP003587393 RP003592155 RP003608835 RP003627394 RP003634003 RP003641284 RP003665458 RP003671430
End(s) extend beyond the annotated transcript, internally consistent	CK01378 RP003408929
Sequence
	TTCAGTTGCAGTTTTATCCTCAAAGACGATTCATCATATACTCTTACTCC AGTATCGCTAAAGAAGCTAAAAGTGTTTTCAAAATGAAATTCTTGATTTT CTGTCTGATTGCTCTGTTTGCCATAGCCTCGGCGCGTCCCCAGTTCGGAT TCGGCGGATTTGGTGGCGGGCTTGAGCAGCAGCAACAGCAGGGCGGTTTT GGACAAGGATTCGGTGGTTTCGGTTCCTTTGGACAGCAGCAACAGCAGGA AAGTTTTGGCGGAAATGGAAACTTTGGTCAGCAGCAACAAGAGTTTGGTG GTTTCGGCGGTTTTTACGGTTAAATACTAATGAACTGATAATTTGTCTTA TATGTAAATTTATTAAAAAACTAAATGGAAATCT
Other Products of this Gene
Other Transcripts
	Name FlyBase ID Length (nt) CG4440-RB FBtr0337080 538
Polypeptides
Derived from THIS transcript	Name FlyBase ID Length (aa) CG4440-PA FBpp0080393 79
Derived from OTHER transcripts	Name FlyBase ID Length (aa) CG4440-PB FBpp0308003 79
Comments
	Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences
	RefSeq - An integrated, non-redundant set of sequences • NM_144320
Synonyms
	CG4440-RA
References ( 2 )
FlyBase analysis	FlyBase Genome Annotators, 2004, Changes affecting gene model number or type in release 3.2 of the annotated D.melanogaster genome. Changes affecting gene model number or type in release 3.2 of the annotated D.melanogaster genome. [FBrf0166453] FlyBase, 1996-, FlyBase inference based on genome sequence analysis. FlyBase inference based on genome sequence analysis. [FBrf0104946]