Open Close
General Information
Symbol
Dmel\Idgf3-RC
Species
D. melanogaster
Annotation Symbol
CG4559-RC
FlyBase ID
FBtr0080862
Feature type
Associated gene
Evidence Rank
Length (nt)
1724
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 18 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        Sequence
        ATTTCGTTGATAATAATACCCACAAAACTGCGTTTGCTATTGTTCGTCTGGGGTTTTCGTTTCACTACGGGGAAACGCGA
        GGAGGTGATTCCACTGAAAAGCTCCACTGTGCCCATATTTATTCCAATTCCCGTGCTAAGTGTCATTTCGAATTCAGTTT
        GGTTTCGCATCTCGCCGGCGACGGAACGCATTGCGAAGTATTGTAATGACTGGCTCTCTTTGGCTCAGTTTGGCACTGAG
        TCTAGCGGTTTTGGCTCAATTTAAAGTGAGCGCCGCTCCTAATCTGGTTTGTTTCTATGACTCGCAGGGCTCTCAGCGTC
        AGGGCCTGGCTCAGTTTTCGATGATCGACATCGAGCTAGCCCTACAATTCTGCACCCATTTGGTCTACGGCTATGCGGGT
        GTTAATGCCGATAACTATGAAATGCAGAGCATTAACAAGCGATTGGACCTTGAGCAGCGTCATCTGGCCCAGATCACTAG
        TATGAAGGAACGCTATCCCCACATCAAGTTCCTATTGAGCGTTGGTGGCGATGCCGATACCTATGAGGGTAATCAGTATA
        TAAAGCTCCTGGAATCGGGACAACAGGGCCACAGACGCTTCATCGAATCTGCTCGAGATTTGGTGAGACGTTATAATTTC
        GATGGTCTGGACCTGGCTCTCCAGCTTCCCAGAAATAAGCCACGCAAAGTTCATGGGGATGTGGGCTCTGCGTGGAAGAG
        TTTCAAGAAGTTCTTCACCGGCGACTTTATTGTGGATACTGAATCGGAAACGCACAAAGGACAGGTGACTGCACTGATCA
        AGGATTTGAGTGCCGCTCTGAAACAAAATGATCTGCTGCTCAGTCTCACCGTTTTGCCAAATGTGAACTCCAGCTGGTAC
        TATGATGCCCCGTCGATCGCCCCAAGCCTGGACTTTATCAACCTGGGAACTTTTGACTTCCTGACCCCGCAGCGCAATCC
        CGAGGAGGCGGACTTCTCGGCGCCAACATATGAGGCAGTTGGACAAAATCGTTTGGGCCACTACAATCTAAACTTCCAAA
        TGGAACACTGGTTGCTTCAGAGAGTGCCGGCTAATAAGATAAACATTGGCATTGCCACCTATGGCAGGTCGTGGAAGATG
        AGCAAGGATTCGGGAGACTCTGGTATGCCAGTGGTTCCCTCCACCCAGGGACCTGCTCCAGCTGGACCTCAGAGCAAACA
        GGAGGGTCTGCTCAACTGGGCTGAGATCTGCTCACTGATGCCCAACCCCAGTAACTCCAATGCCCGAGGTCCTAATGCTC
        CGGTGAAAAGGGTTGTGGATCCCACCAAACGTTATGGCAGCTACGCCTTCCGTGCCGCCGATGAAAATGGTGACCATGGA
        CTGTGGATCAGCTACGATGATCCGGACTCTGCCTCCAGCAAGGCTATGTACGCCAGGGCAAGGAATCTCGGTGGAGTGGC
        TCTGTTTGATCTGACCCAAGACGATTTCCGTGGTCAGTGCACAAACGATCGCTTCCCCATGCTGCGCGCCATCAAGTATC
        GACTTCTCTAAGCCGACTTCTCTAAGCCAACTTCTCTAAGCCAACTTCTCCAGTCCAGACCATAAAGACATCTCCAGCAC
        GCAAATGTCACAAGAAAAGTTGGTGAAGCGGAGCTGGGAGGGAACAAATGTCACCCTTTCGGTGCCTAAAAGGCCTCCTT
        CTGTGTCTGTCCCTTTTTGCAAATTAATTACAAAGTTGTAAACT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0080864
        1649
        FBtr0080863
        3145
        FBtr0342945
        3801
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0080419
        441
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0080421
        441
        FBpp0080420
        441
        FBpp0309719
        441
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG4559-RC
        Idgf3-RC
        Secondary FlyBase IDs
          References (2)