Open Close
General Information
Symbol
Dmel\Idgf3-RA
Species
D. melanogaster
Annotation Symbol
CG4559-RA
FlyBase ID
FBtr0080864
Feature type
Associated gene
Evidence Rank
Length (nt)
1649
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 98 )
Sequence
TCAGTTTGGTTTCGCATCTCGCCGGCGACGGAACGCATTGCGAAGTATTGTAGTACGTCCCCCTCCCCAAAGTATATAGT
ATTTGTTTTGACATCGTAAAGCAGCTCTCTGGGTTTATCGCTCTGCAAAGATGACTGGCTCTCTTTGGCTCAGTTTGGCA
CTGAGTCTAGCGGTTTTGGCTCAATTTAAAGTGAGCGCCGCTCCTAATCTGGTTTGTTTCTATGACTCGCAGGGCTCTCA
GCGTCAGGGCCTGGCTCAGTTTTCGATGATCGACATCGAGCTAGCCCTACAATTCTGCACCCATTTGGTCTACGGCTATG
CGGGTGTTAATGCCGATAACTATGAAATGCAGAGCATTAACAAGCGATTGGACCTTGAGCAGCGTCATCTGGCCCAGATC
ACTAGTATGAAGGAACGCTATCCCCACATCAAGTTCCTATTGAGCGTTGGTGGCGATGCCGATACCTATGAGGGTAATCA
GTATATAAAGCTCCTGGAATCGGGACAACAGGGCCACAGACGCTTCATCGAATCTGCTCGAGATTTGGTGAGACGTTATA
ATTTCGATGGTCTGGACCTGGCTCTCCAGCTTCCCAGAAATAAGCCACGCAAAGTTCATGGGGATGTGGGCTCTGCGTGG
AAGAGTTTCAAGAAGTTCTTCACCGGCGACTTTATTGTGGATACTGAATCGGAAACGCACAAAGGACAGGTGACTGCACT
GATCAAGGATTTGAGTGCCGCTCTGAAACAAAATGATCTGCTGCTCAGTCTCACCGTTTTGCCAAATGTGAACTCCAGCT
GGTACTATGATGCCCCGTCGATCGCCCCAAGCCTGGACTTTATCAACCTGGGAACTTTTGACTTCCTGACCCCGCAGCGC
AATCCCGAGGAGGCGGACTTCTCGGCGCCAACATATGAGGCAGTTGGACAAAATCGTTTGGGCCACTACAATCTAAACTT
CCAAATGGAACACTGGTTGCTTCAGAGAGTGCCGGCTAATAAGATAAACATTGGCATTGCCACCTATGGCAGGTCGTGGA
AGATGAGCAAGGATTCGGGAGACTCTGGTATGCCAGTGGTTCCCTCCACCCAGGGACCTGCTCCAGCTGGACCTCAGAGC
AAACAGGAGGGTCTGCTCAACTGGGCTGAGATCTGCTCACTGATGCCCAACCCCAGTAACTCCAATGCCCGAGGTCCTAA
TGCTCCGGTGAAAAGGGTTGTGGATCCCACCAAACGTTATGGCAGCTACGCCTTCCGTGCCGCCGATGAAAATGGTGACC
ATGGACTGTGGATCAGCTACGATGATCCGGACTCTGCCTCCAGCAAGGCTATGTACGCCAGGGCAAGGAATCTCGGTGGA
GTGGCTCTGTTTGATCTGACCCAAGACGATTTCCGTGGTCAGTGCACAAACGATCGCTTCCCCATGCTGCGCGCCATCAA
GTATCGACTTCTCTAAGCCGACTTCTCTAAGCCAACTTCTCTAAGCCAACTTCTCCAGTCCAGACCATAAAGACATCTCC
AGCACGCAAATGTCACAAGAAAAGTTGGTGAAGCGGAGCTGGGAGGGAACAAATGTCACCCTTTCGGTGCCTAAAAGGCC
TCCTTCTGTGTCTGTCCCTTTTTGCAAATTAATTACAAAGTTGTAAACT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0080863
3145
FBtr0080862
1724
FBtr0342945
3801
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0080421
441
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0080420
441
FBpp0080419
441
FBpp0309719
441
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Idgf3-RA
Secondary FlyBase IDs
    References (2)