Open Close
General Information
Symbol
Dmel\grp-RB
Species
D. melanogaster
Annotation Symbol
CG17161-RB
FlyBase ID
FBtr0080884
Feature type
Associated gene
Evidence Rank
Length (nt)
2234
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 76 )
Sequence
TCCAGTTTTGCTCCAGCCCTATCGCAAACTAAAGTATATTTTAGCAGCGTTTGCGGAATTTTTTGCATTTCAGTTACTCC
AAGTGTGAATAAGAGCACGGTCGCTGTTATAGTGTCTTGCAAAGCAGTGAATTAAAAAAGTTTAATAATCCAAATCGAGA
ATCCCAAATTTGTGTAGACGTAGCAACAACAGTAAAACGCGCTGGCCGGAAAAGACGCTGCTGATATGCACGAGGTGGCG
AAAGCTGAGCTAGAATCGGGCGGCAGATGACAAGGACAACGCCACGCACATGGCGGCAAGGCTACAACAAGGATACAGGA
TACGGCCAACCGGATATTAAACCATCAACACTAGCCAGCACAGCAAAGCAAAATTAAGGAACAACTGCAATCCCGGTACA
CCAGTACACCATGGCTGCAACGCTGACGGAAGCGGGAACAGGTCCTGCGGCCACCAGGGAGTTCGTCGAGGGATGGACTT
TGGCCCAAACTCTGGGCGAAGGTGCCTACGGCGAGGTAAAGCTACTAATCAACCGGCAGACTGGCGAGGCTGTGGCCATG
AAAATGGTGGATCTAAAAAAACATCCGGATGCAGCGAACTCGGTGCGAAAGGAGGTATGCATACAGAAGATGCTCCAGGA
TAAGCATATCCTCCGATTTTTCGGCAAACGTTCGCAAGGCAGTGTGGAGTACATATTCCTGGAATACGCCGCCGGCGGAG
AGCTATTCGATCGAATAGAACCAGACGTGGGAATGCCGCAGCATGAGGCTCAAAGGTATTTTACACAGCTCCTGTCCGGA
CTCAATTACCTGCATCAGCGTGGGATCGCTCATCGGGATCTGAAGCCGGAAAATCTGCTGCTTGACGAGCATGACAACGT
GAAAATATCGGACTTTGGCATGGCTACTATGTTTAGGTGCAAGGGCAAGGAGCGACTGCTGGACAAACGCTGCGGCACCT
TGCCGTATGTGGCGCCCGAGGTGCTACAGAAGGCATATCACGCCCAGCCGGCGGATCTCTGGTCGTGTGGCGTTATATTG
GTGACAATGCTGGCGGGTGAGCTGCCCTGGGATCAGCCGTCCACCAATTGCACGGAGTTCACCAACTGGAGGGATAACGA
TCACTGGCAACTGCAGACTCCTTGGAGCAAACTGGACACCTTGGCTATTTCGCTGCTTCGCAAGCTGCTGGCCACCAGTC
CTGGCACGCGTTTGACCCTGGAGAAAACCCTGGATCACAAATGGTGCAACATGCAGTTTGCAGACAATGAACGTTCCTAT
GACCTGGTGGACTCGGCGGCTGCCCTGGAGATATGCTCGCCAAAGGCTAAGAGGCAGCGTCTGCAGTCTAGTGCCCACTT
GAGCAATGGCCTGGATGACTCCATCTCCCGGAACTACTGCTCTCAACCCATGCCCACAATGCGCAGCGACGATGACTTCA
ATGTCAGACTGGGCAGTGGCCGATCCAAGGAGGATGGAGGCGACCGCCAGACGTTGGCCCAGGAGGCTCGGCTCAGTTAC
TCCTTCTCGCAACCAGCTTTGCTTGATGATCTCCTACTGGCTACCCAGATGAACCAAACGCAGAACGCTTCCCAGAACTA
TTTCCAGCGTTTGGTGAGGAGAATGACCCGATTCTTTGTGACCACACGATGGGATGACACTATCAAGCGATTGGTGGGAA
CCATCGAAAGACTGGGTGGTTATACGTGCAAATTTGGTGACGACGGAGTGGTCACCGTATCCACAGTCGATCGGAATAAG
CTGCGATTGGTTTTCAAGGCACACATTATAGAGATGGATGGCAAGATTCTTGTTGACTGCCGGCTGTCAAAGGGTTGCGG
CTTGGAGTTTAAACGACGATTTATCAAGATCAAAAACGCCCTGGAGGATATCGTGCTTAAAGGACCCACCACCTGGCCGA
TTGCGATTGCTACAAATTCGGTGCCTTAGCTTTTAGTTTCATTCGAACTTAAAATCCTGTCTTGTCTTGTATTCGGTTAT
ATTTACATTTGTCTAGCCTGTAAGAGCAACTCATGCATCACCTTCGATCAGAATCATCTAAAATTCTCAATGTGCTAACT
TATTTTTAATTCATTGCATTGTTTACGAGTACGTTGTGTATTGCTAAGCGGGCTCTCATTCGATTTTAATTTTGTTGAAT
TTTAAAGCAAAAGTCGAGTATTGAAAACTAGTTTAAATGTTATCGAACAATAAATCTTATGCGATTTTGAGTAG
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0080886
2563
FBtr0080885
2344
FBtr0100459
1649
FBtr0339514
2010
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0080441
512
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0080443
512
FBpp0080442
512
FBpp0099886
398
FBpp0308597
398
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG17161-RB
Secondary FlyBase IDs
    References (2)