Open Close
General Information
Symbol
Dmel\Phlpp-RA
Species
D. melanogaster
Annotation Symbol
CG10493-RA
FlyBase ID
FBtr0081149
Feature type
Associated gene
Evidence Rank
Length (nt)
3281
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 1 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CGTGTTCGTCTTCAGTTGAGCGGTCGCTTTTATCGGGTGCGGATATCATATAGTAACATGTAGGAGTATTACCAAATTCA
          GACAGTTGCCTATTGCCACATCTCGGCAAGTCCCCTTTAAAGAACTAATAAGTGCAGGCAAAAGGTGATATGAATTAGTG
          ACCGAGTGCAGTTAGGTTTTAGAAATAACAGTGTAGTGGATTATTACCCCACTAAAACAAATGAAATCCGCTGCGATCGC
          CACTCGATGGGTGTTCGTTGATGCATAGCGAAGTTGGAGTCTTTGCCAAGAGCTCGAAGTGAAATAAAAGAAACCCCCAA
          GAGGGCCGGAACAATGCTCAAAGCCACGAGGAAGCAAGCGGATCCGTACAAATCGAAGCTGAAAGTTAGTGCCAGCCACA
          GTGGACCGCATCCACTGCCCGTCGAGGTGACGGCGGCAGAGGAGGAGCAGGCCGCCACTTTTGGCCAGACATCCCCCCAG
          AAGCTCAGCCTGAAGGGCAGCCAACTGGGCGGCAGCATTTTGATTGGCAACTACAATTATTTGACCCAGCTGGAGGTATG
          CGAAAACGAAATGGAGGTCTTGGATCTCAGTTCGCTCGCTCAACTGGAGACGCTGAAGTGCAGCCGGAACAAGCTGATGG
          AACTGATCATAAATGGCACCAATTTGCAGACACTTGTCGCCGACCATAATTACCTGCACAACATATCCACAACGAACACG
          CATCCAGTTCCGCTGAAGTTGCAGCGCATTGACATCTCTCACAATAACTTCAGTGAGCTCCCCAACTGGGTCGGAGCATG
          TGCCTCCTTGACCGCCATAAATGCTTCACACAATCGCCTTAACAACGTGGCAGTACTGTTACGCAACTACAGGATAACTG
          AGCTGGTTTCCTTAGACCTGGCATACAACGATCTGAAGCAACTGGACCAATTTCCGGAGGGCTTTTCAAGCATCCGGAGT
          CTGCAGTTGCAAAGCAATGAGCTACCGAGTCTTCCGGACAACTTTTTTGCCGTGACCCACGCTCGCCTGGAAACGCTAAA
          TGTCTCCTGCAACAAACTGTCCACCCTGCCACGCTACGAACAGAATAACCATGCTGCGCTGGTTAATTTATCCCTGGCGG
          GGAATCACCTGAATGATAGCATCTTTGAGCCCTTGCACAATGCCGCCAAGTTGAGAGTTCTCCATCTGGCCTACAATCGC
          ATCGGGGTCCTGCCCGCCGCCTGTGTCCGCAACTGGCCGGAACTGGAGATCCTAGTTTTATCTGGTAATATGCTGCAACA
          ACTGCCCGAGGAGGTGGCCACTTTAGGTCAGCTCAGGGTGCTACGCTGCTGCAACAATCTGCTCCTCTGCACGCCGCAAC
          TTGCGAAGTTGGCCATGCTGAAGGTCCTTGATCTCTCGCACAATCATCTGGATCGCGTCAATCTGCTAGCATTGGTTCCA
          TCAAGGAATCTAAAGTACCTGGATCTATCGGGAAACTTGCAGTTGCAGGTGGACGAGCAGCAGTTCAAGGTTTGTCAGAG
          CCAGAGCCAGCGCCATTGGAGCCTAGTCGATGTCTCCGGAAACAATAGAGCTGCTTTGCCTACTACCAAGATCAGACAGG
          TGAGTGCCCAACGGAATCAGAACAAGACCAGTGGGCCTTGGACCATGGGATTTGCGGAGACTCCTGGCTCTGGTGATTGC
          CGGAAGCTTTCAGTTTACCAACTAAGGGCAGCAAACTACGGGGGATCTGATGAGGCTCTGTACGGGATGTTCGAGGCATT
          GGAGGGGCGCGGCCGGGCTGCCCAGGAGATGTCTCATTTGGTGCCCGATCTGATGAAGCAGGAGCAGATGGTCAAGGACT
          CGGCGGTCAGGGATTACATGAAGTTTACCCTGCTGGCGGCGCAGCAACAATGTGGTAGTGTGCGGAGTGCCGCCTTATTC
          CATCTGACCAGGACACGGGCTCCTTCCAAAGTAAGACCGCTGAAGAGCAAGCGATACGTCCTACGCATGGCAAGCACTGG
          AGGTCTGGACGCCTACCTGATACGACGCACCTCCCAGTTGCGTCTTACCAAGCCGGATGTCATTCAAAAGGATCAGATTC
          ATTCCATGCCAGATCCACATGTGTTAGAGCTCATTCTCAGCAACGACGATGAGTACTTGGTGGTGGGCAATGCTCAGCTC
          TGGTCAGTGATGGATATTGATCGTGCAGCCCGAGAGATCCGAAAGGAGGAGAATTCCCTGCTTGCGGCCAAGCGACTGGT
          GGACATTGCTCAAAGCTTTGCTGCGGCGGAGAGTCTCAGTGTAATTGTGGTTCGCTTTCGCCACCTCGGTACGGATGTGG
          ACCACCTGATACGAGAGCTTAAACAAAGTGTGCGCAAGAAGCCCCAGCCGGTTTCCTTACCTTTGTCCAGTGGATCAGTT
          TGCAAGCGAACGTGCTGCGACCGGAGCAATGCCTGTCGCCACCGAGCCATTGAACAGGAGCCGCTGGCAGGACGATCCTC
          GCCAAGTGGGCAAAGTGATCGGGACTTGCTGGCCAAGGATAAGGACGACGAGTTCGTACTAGCCCATGCCCGTGTCCTGC
          AGGAGGAGCAACAGCTTGAGATGCTGGACGAAACAGAGTCGGTATCAGAATCAGTGCTTTCTGAGGAGCAGTTCAAGTGC
          TGGGAGTACATGCTGGAGCAGAACACCCAGCTGCTGTTCGATAAGGAGCTAAACACCATCTCTAAGTCTTTTACTAAACA
          ACGTACCGTACCCAATGCTATCATGGCAGCTACAGTTCTCCCAGAACGCAATGACTTTACCTCGAATTTGATGCGGACTG
          TCACCAACAAGTTCATCTCGACCAGCACTCCTCAATTACCCCAACCCATAACGACTTCTGTGCCCCTGGGTTCATATCAT
          CAGGTGAAGCAAGCGCCTCCTGGACACTTTGGCAGTGCCCTCTCCTTCCAGCAGGCCCACAGCTACGGCTATAATCTGTT
          TGATGCCAAGCCAAGGCCCAAGTTTCACGGAGGCACAGTCAAGCGATCCGCAGGACCAAATTCAGCCTACTTTGGATCCC
          TTCAGCGCCTGATGCCCTACAATTTCGAGTACGACTTTGCCGTTACCCAGGAGAGGGAGAGAAACATCCTGGACGAAGAG
          GAGCACGACGATGATGACTTCAACGAGCACGAGAGTAGAATGCGAAAATACTGGGGAGTGGCCACGACGGAACTTTAGTT
          TAGGGTTGTCTTTCACCGCGTTATTTACAATAATTTCAAATGTAAGAAAACCATCGTTAGATAAATCCATTATCCAAAAC
          T
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0336844
          3466
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0080693
          954
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0307805
          954
          Comments

          UTR(s) based on RNA-Seq data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG10493-RA
          Phlpp-RA
          Secondary FlyBase IDs
            References (2)