Open Close
General Information
Symbol
Dmel\CG10702-RA
Species
D. melanogaster
Annotation Symbol
CG10702-RA
FlyBase ID
FBtr0081175
Feature type
Associated gene
Evidence Rank
Length (nt)
3934
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 24 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CAGTCGGCAGTCGATCGTCGCGAGGTGAGCACCGCGTCGCGCTCTCGCATCTCCCATTTTGCACTGGGCGAAAAGATCCT
      TCGAACAAGTGCGCGAAAAAGCACAAGATGTTTTTACAGTGTAAATTACAAAATACAATTTCTTAAAAACTAAGTGCTTC
      ATCCATTGAGGTAGTGACGATCAAAGTGTTAATTCCCCTGGAAATATATTATATATTATAATATAAATATATACATTTAA
      AAAGAAAATGTATTTAAACTATTAAAGAATTAGAATTATAAAGATTTAATTTATGCCCATTATTGTATAAAATTTAAAAC
      GGAATCGCTAGAATCTGTATTTAAAAAAATACTATCAAAAATTATCAGTGATTTTAAAAATTGTTATTTTTAAAAATGTT
      TATAACACACTTGTTTTTCAAGCTCAAGATCCTGATGCCGAGCTAATAAAGAATATTTGAAAATTTGAGACAAGCAGACC
      TGCTTTCTTGAAATGAGTTGTTCTGTTGTTCTGCCCAAATACCATAAGAGAATTTATAGTTCTCTATTAGGAAAAGATGA
      TTTGAGTGTATGGCAACCCCCGCGAGTGAATATAAGAGCCGAAGATCGCTCTGCATGAGCCCAAAACTAATCCAATTAAA
      AAACAAACAATAAACAAATACGATCGAAGGAATTGTTTTTGACGTGCGTAATGCGCTTGTGTGGTAACGTGTTTGTTTAC
      GCTTCCGATCTAGACAGTGAACCAAAATAATTAGCGTAGATTTAACAACAAAAAGCGAGCCCTCCGTGCGCGATATTTCG
      CCAACGATAGCGAGAGCTCAAAAAAAGCGCCCAAGTCATAAATATCGGTCCTAATCAGATGGACGCTGGAGAGTAAGGGC
      GCTAATTGGGCGTGCTACATATGTATGTACAACTAACTGTAAGCTGATCGGATCGAAAAAAAAAACATAGGTTCGGTAGA
      AGCGTCGCAATATGTGGGGGCGACAGCGCTGCCGGCAAAAGAAGCTAAAGAGGATAAGCGAAAAATAAACTTCAAAACTC
      TTTTCAAGTACAAGCTTGGCAACATGCACTGCGGCAACATGCTGCTGGGCGTTGGCCTCATGTTCCTGGCGCTATATGTC
      CCCTGCGCCGAATCCAAAAAGGAGCACGAGTGCACCAGCATCGACATCCGAAACGAGTGCAAGAACATGCATCTGCTGGA
      CAACTGCACCGTTGTCACCGGATACGTGATGATCACGCTGATCACTATCGAGCAGCGCTGCAATTTCTCGGAGTACTCGT
      ACCCACTGCTCACCGAAATCACCGAGTTCATGATCTTCACCGACGTGCGCGGCCTGGTCAACATCACCGAAATGTTCCCG
      CACCTGACCGTCATTCGGGGTCGCCGGCTGTTCCTTAACTACGCGCTCGGAGTGACCAACATGCACGAGCTGGAACAGTT
      GGTATTTCCCAAATTGGTGGCAATACAACGAGGACAAGTCTACATCGGCAGCTGCCCCAAGCTCTGCAGCATCGGCCGTG
      TTAATTGGGATCTGCTGACTCTCACCAGAGGCGAGAACAACATAATAATGGTGAATAAAAACTGCAGCACACCGGTTTGC
      TCTGGATGCAGTTCCTCCCACTGCTGGTCGAATCATTACTGCCAAAGATCCATCAACGAAAATGTCGCCAATCCAAAGGC
      CAACATAAACGCCTGCCATGAGGAGTGCTTGGGCGGCTGCAAGAACAACTCATCATCCCCAGCTGACTGCAGCGTTTGCC
      GCGGACTCAGTGATGATGGTGTCTGCGTGAAGAGCTGTCCGAAGGACAAGTACGTCATGGAGAACTATCAGCGCTGCTAT
      ACGAAGGCCGAGTGTGTGCTAAAGCACGGCTATGTTATTTCCGGATCACAGTGCGTAGCTTTCTGTCCCAGCGGCTACAA
      GACGAACAACCGGTCGGAGTGCGTGCTCTGTAGCCCCGATGAGGCTTGTATCAGCTTCTGCACGCCGGAGTGGCCAGGAA
      AAGCGTTCACCGTATACAATCTGGCTGATGCAGAGAATTTGCGTGGCTGTCAGATCTTCAATGGCAGCCTGGTCATCACA
      ATCCGCAACAAGGTGAACGAGACGCAGCTGTACCAGAGCTTCACTAGTATGCGCGAGGTTCGTGGGCATGTTAAAGTCTA
      TCGTTCCTCCCAGCTAAGAAGCTTGCAATTCCTGAGAAACCTAGAGCGCGTTCACGGTGATCCCCTAGAGAATCGCCACT
      ACTCCTTCATACTTTATGACAACAAGGAGCTGTCCGAGTTGTGGACACCTTCGCGGCAACTGGAGTTCATGGAGGGCGGC
      ATGTTCATGCATCGCAACAACAAACTGTGCAACCGGAGGATGCGAGAATTCCAAAACGCTGTGACCCATGATAGAGCCCT
      GGACTCCCTGCAGACCAACGACCAGGAGGTGCAGTGCAGCCCCTTGAAATTGCAGCTATATGTGCAGAAACGAACCCATC
      GGTCTGTGAAGCTAAGCTGGCTCAAGTCTCAAACAAGCCAGAAGATCGAGCTGATCCACCGACCTTTATTGCCGGGGAAA
      CTATACCACGAAGAAAGTGAACTGGACGCGCCCATATGTACACGAATCAACTGGAAACGACGCCTGCTCTTCCCCGACGA
      TCTGATCGAAAATGGCACACACTATCTTTTCGACTTGGATGATCTTCAACCGGACACACGGTATGTCGTCCTGTTGCGTA
      CTTTCGGCAATGATGAGGCGCATGAAGCGTATGAGGCACGCAGCGAATTGACCTACGTGCAGACGGAGCTGGACATACCA
      AAGCCTCCGTTGCTGGAGCTGGTCAAGAAGACGGATAGCTCGCTGACGGTTCAAATGGCCAGTCACGACCATGTTAGCTT
      TCTTCTGACGGTTTTCGAATTAAGCGATGATCAGGATTATATAGAACAGAGGAACTACTGCCACCAGCCGTCGTACGTGT
      GGCAGGACATGGACGGCCCCAGGTGGATGGCGTACGAGGACTACGACGACTGTTGTGCCCAGAAGGCCGAGCAGTTTGAG
      GACTCTCGTTTCATTGCGGACATGAGGGAACAATATCGCTGCACCCTTGATGATCGCGAGCAGTGCCGACGACTGGCACA
      TACCGAGGTCTCGCTTCCACAGCTTCGGCTGCCGGGAAACACCACGGAGTACGAGCTTAAGGCGCTGCATCGCTATCGCC
      TGTACGCGCTTCAGCTGCAAGCCTGCAATCCACTGGGATGCAGCAGCCACACAACGCTCTACGGACGAACGAACTATACA
      ATGGGTGCCGATCTTCTCACCCAACTGTATGCCTGCCATATTCCGGAAATGGACAAGTACATTATGCGCTTCGAGGAGCC
      TAAGAAGCCCAATGGCCTGGTGACCAACTACGTAATCCACTTTCGCAACAACTTCTCGCAAACCCACGTCGGGTGTGTAA
      CGCGGATGGATCACCAGAGTGCCGGCTACATGTACGTGAAGCAGATAAACATCACTTTCACCGAGTGCGCTGTGCGGGTC
      CACTCCCTGGCCGGCGATGTGATGACGCCCTACATGCCAATCAGCCTGTGCAGCGACGAGGACCGCCTACAGGCGTTTCA
      CAGCAGGGAGGCCAAGGATCTTTCGCCAGAAATCACAGACTTGCCAGCCACAGCGTCACACGGCCGCGGCATTAGCATAT
      TCCTGATCTGCTTCCTGTTTGGGTGCAGTGTATCGCTGGTTTGGGTTCTTTACAAGCGGCGATGTTGGAGAAAGTTGCCG
      GGACTCCGGCGATATGTGCCAGTGCGGGAGCAGTGGCTTCGGGACCGACAACAAACCGAGGATCGCGAAATCCTTGTCGA
      CGGTTTTGAGACAGTTCGATTTCAAAACAACAACAACAGCCAGGCGGACGATTATCCCATGTAAACGATAATATACATTT
      GTATGTGAAAACTT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0081174
      4145
      FBtr0081176
      3893
      FBtr0303241
      4041
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0080717
      946
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0080716
      946
      FBpp0080718
      946
      FBpp0292333
      946
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG10702-RA
      Secondary FlyBase IDs
        References (2)