Open Close
General Information
Symbol
Dmel\CG10237-RA
Species
D. melanogaster
Annotation Symbol
CG10237-RA
FlyBase ID
FBtr0081207
Feature type
Associated gene
Evidence Rank
Length (nt)
1338
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 38 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Sequence
        TTTTCAGTCTTCAAACGCGACCCAAGCTCACTAGGTACATATATCGGAGTCGAACGGGAGTTCCGAAGGATTTCCACTGT
        ACCAGCCAACTATTTGTGGATTAGCCGATTTTCAATTCAAACAAGGAGTACCCACCATGCTGTCGGACATCGACCAACTG
        CCCACGCTCCAGGTGGGCGACTACACGCTCCAGTTCGAGTTGGGCGAGCCGACTGCCCAGGGCAAGGAGGTGGCCATCAA
        GGAGCTGCGCGAAACACCCGAGCGCCAGAAGGAGGCCTCCAAGGAGCTGGCCCGTCTTCTAGAAGCGGAGACGGACTTGC
        TGTACCCCAAGGGAAACGAGGAGTGGCTGATCAGATACCTGCGGCCCTGCAAGTATTACCCGGAAAGTGCCCGTGATCTG
        ATTAAGCGGTACTACGCCTTCAAGGTGAAGCACGCGGATGTGTACACCGACCTGAAGCCATCGAACGAGGCCAACATCTT
        CAAGCACAACATCCTTACCGTCTTCCCCAACCGAGATCAACTGGGTCGTCGCATTTTGGTCCTCGAACTGGGCAAGCGCT
        GGAAGCACAAGCAGGTCACCCTCGATGAGGTGTTCAAGGGAGCTGTGCTCTTCCTGGAGGCGGCCATGCTGGAGCCAGAA
        ACACAGATCTGCGGAGCCGTTGTGATCTTCGACATGGATGGCCTCAGTCTCCAGCAAACGTGGCAGTTTACGCCTCCGTT
        CGCCAAGCGCATTGTGGACTGGCTTCAGGACTCGGTGCCGCTCCGGATCAAGGCCATTCACATCGTGAACCAGCCGAAGA
        TTTTCCAGGTGGTCTTTGCCCTGTTCAAGCCCTTCCTCAAGGAGAAGCTGCGCAGCAGGATCATCTTCCATGGCACCGAT
        CGCGAGTCCCTGCACAAATACATGTCGCCCAAGTGCCTGCCAGCCGCCTACGGAGGATTCCGGGAGGCCAGCCGCATCGA
        CAGCGACCAGTGGTACCAGCTGCTGCTCAAGTGCGACACCGAGTTCGACACCATCAACTCGTACGGCTACAAGAAGAAGT
        GATCTGTGGCCACCGGCCTGGTGCTGCTCGTGATAATCAACTCCACTCGTTTCCACACGTCTTCACATTAAGCCCACGTG
        GAGCGTTATAGTTAAGCACTCGATCTACCATACGCTTGTCCTGTTAGTGAGTAGCGCCTAGAGTTTGCCTTAGTCTTAAC
        CAGGATCGGAGTGTCGATCGCAGCCAGAAGAAGTGTTATACCTACATGCATATTATTTTAATCCGGGGTAAGCGTATTTA
        TATCATTTTACTATTGTACATTAAACCAATTGTTAAAATATAAACATACTTTGTAAAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0081208
        1457
        FBtr0081209
        1418
        FBtr0308679
        1720
        FBtr0334176
        2011
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0080748
        301
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0080749
        324
        FBpp0080750
        306
        FBpp0300885
        301
        FBpp0306293
        306
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG10237-RA
        Secondary FlyBase IDs
          References (2)