Open Close
General Information
Symbol
Dmel\Hr38-RB
Species
D. melanogaster
Annotation Symbol
CG1864-RB
FlyBase ID
FBtr0081397
Feature type
Associated gene
Evidence Rank
Length (nt)
7704
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 6 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CCGCATTGTTAACAACTTTAGCCCAAACAGCCACCGCTCACGGAAAAGCCAATACAAAATATAGAACTTATATCGAGGCG
        AGCTCGATGGTTCTGAATTTCCGATCTTAAGTCAGCCAACTAAGACTTTAATCCACACAACTATATAAACATCGCGTTCA
        GTATTAACGAAACACAAAGCCAACATAGGTGTGAGTGCTCAAGAGTTAAACAATTGCAACAAGTTGTTGTTCTTTATCGA
        TTCGTGCATTCGTTCTATGCGGAAACGGAAGCCGGTCGACAGCGCGGCGTATGCGTAATAACTTCCAACGGTTGACAACG
        CGGCGTATACTTCACCTTTACCTTTCTTAAGCGAACAATGCATATATTTCGGTGGGCAACGCTGCGTATGTTTGTTTAAT
        CTATCTTACCCCGCTGCGAATGTGCAGTAAATTAATCTATAGTAATTCAAATTTCGTTTCATTTCTGAGAGACAAGACAC
        AGATATTTTTGAACTGAAAGTTTTGCTAACATTTTAACGAGCACGTGAGCTGAAGAACAGTAGTAATTGTTTTTGTGTTG
        CCCATTGCGCGCGTGTGTGTATCAGTGTGTAAAGTGTAAGCAACGTCCTTGTGCCTCCCACTACTGCAACTACCACAACC
        GAATATATATGTATATGTATATAGAGACCCCAGTTGATATAGTATAGCGTGCGTAAGTCGTTACGTCGCTTACATCGTCA
        CTTGGCCACTGCGCAAACGCCGGAAAAAAGGAAAGGCAACAAGAAAAAAGCCAAAAAAAAAAGGAGGCAAGTTCAAGTCT
        AAGGACACACAACAAAAACAACAGCCGGGCAAGGACAGAAAAATGAAGCCCGATAATAACTACTGCAATCAGAGCTACTG
        CGACAAAAGCTTCGGCCACTCCTGCCGCAGCCAAGAAAATTGAGGCAAAATCCCAGCCCAACTCGGAACAGTCGTGCTGG
        ATCACCAGCGCCGCTCGGGGCGCCAAACAGGTGCCTATTTAGAAACCATATAGTGTGTGATCTGTGTTGTCCCGTCCTGT
        GTGCGTTTTATGTTTGTGTCCCATCATCACCATCAACATCATTGTTAATTTTGGGTTCTTTAACGGAGAATCGTGGTCTA
        TGATGCGCGATCGGCTTGCCTCGCTGATTGTGGTGAAGCAAGAGGGCGGCAGCAACACGAGCATTAGCCACCACCAGGCA
        ACGGCCATTAAGTGCGAGGCCTCACTGTACACCGAGAGCAGTTTGTTCCAGGAGATCAACAACAACTCCTGCTACAGACA
        GAACCTCAATGCCCCGACACACCAGCAGTCACACACATCACACCTGCAACACGCACAGCAGCACCAAACACACCAGCAAC
        ATCCCCTCTTGCCGCCGCCTCTGCCGACTCTGCCTTTGATTTACCCCTGCCGCAACCTCTTTCCCGACGGTTGCGATATC
        AATCACCTGGCCTGCTGCAGTTCCTCCAACTCCAACTCCAACTGCAACTCAGACTCGAACTCCACCTCCAGCTCACCCGG
        CAACAGCCACTTTTTTGCCAATGGAAACACATGTGCAGCGGCACTAACACCAGCACCGCCAGCCACTGAGCCGAGAAAAA
        TAAAACCACTCGGCGCGGGCAAATTGAAAGTCGGGAAAACTGACAGCAACAGCGACAGCAACAGCAACTGCGACAGCCGA
        GCAGCAGCAGCTGCCAGCACCTCGGCCACATCCGCAACATCAGCAACGACACTTGCCGCAACAGCAGCAGCAACAGCAGC
        AGCAGCAGAAGCGGGAGGAGCAGCATCAGCAGCAGCAGCAGCCAAAATCAGCCAAGTGAGGCTTACTAACCAAGCCACAA
        CAAGCATGTTACTTCTGCAACCCAATAGCTCCTTTAGTTCATTGTCGCCCTTCGATAACTTCTCCACGCAAACCGCCTCG
        ACGACCACCACGACGTCGGCATCGGCAGCTGGACACCACCAACACCATAACCACCTCCTCCATCAGCAGCATCACAACCA
        GCAGCAGCAGCAGCAGCAGCAACAGCAACAACAACAGCAGCAGCAGCAGCAGCAGGAACATCTGCAACAGCAACACCAGC
        AACAGCTTGTGAGCCCCCAGCAACACCTGCTTAAGTCGGAGACTCTGCTCTCCCATGAGGAGGATCAGTTGATCAGCAAC
        CTGACAGACTCGTCTGTCGTGTCGCACAGCGAACTCTTCTCGGATCTCTTCTTCCCCTCGGACTCCAACAACTCCCTGCT
        CTCGCCCACCACCAGCGGCTATCCGGACAATCCCGCCGAGGATCTGACCAGCTCCATTGAGAACCTCACCAAGTTGACGT
        GCCTGCGGGACAAGCGACTGTCCTCGATCCCCGAGCAGCAGCTCAGTTCCGAGCAGGAGCAGCAGCTCTGCCTGCTCAGC
        CTGCGTTCCAGCAGCGATCCGGCTATTGCATTGCACGCACAGCAGCAACAGCAACAGCAGCAGCAACAACAGCAACAGCA
        GCAGCAGCACCAGCAGCAGCAGCAACATCTTCAACTCCAGCTGATCTCGCCCATTGGAGGGCCCCTGTCCTGTGGCAGCA
        GCTTGCCCAGCTTCCAGGAGACCTACTCCTTGAAGTACAACAGCAGCAGCGGTAGCAGCCCCCAGCAGGCGTCCTCCTCC
        TCCACCGCCGCCCCCACGCCCACTGACCAGGTGCTGACCCTCAAGATGGACGAGGACTGCTTCCCGCCTCTGTCCGGCGG
        CTGGAGTGCCAGTCCGCCCGCCCCCTCCCAGCTCCAGCAGCTGCACACCCTGCAGTCTCAGGCCCAGATGTCGCATCCCA
        ACAGCAGCAACAACAGCAGCAACAACGCGGGCAACAGCCACAACAACAGTGGGGGCTACAACTACCACGGCCACTTCAAT
        GCCATCAATGCCAGCGCCAATCTGTCGCCCAGCTCCTCGGCCAGTTCCCTCTACGAATATAATGGTGTTTCCGCAGCGGA
        CAACTTCTACGGACAACAGCAGCAGCAGCAACAGCAAAGCTATCAGCAACATAACTACAACTCGCACAATGGCGAGCGTT
        ACTCGCTGCCCACGTTTCCCACGATTTCGGAGCTGGCTGCGGCCACTGCTGCTGTCGAAGCTGCGGCGGCGGCCACAGTC
        TCCTCCCCTTCGGTGGGCGGTCCGCCGCCAGTACGCCGAGCATCGCTGCCGGTTCAGCGAACCGTTTCGCCAGCCGGCTC
        CACGGCGCAGAGCCCCAAGCTGGCCAAGATCACACTGAACCAGCGGCACTCCCATGCCCATGCCCATGCCCTACAGCTCA
        ACTCGGCACCCAATTCGGCGGCAAGTTCGCCAGCGAGTGCGGATCTGCAGGCGGGCCGTTTGCTCCAGGCTCCGTCGCAG
        CTGTGTGCCGTTTGTGGCGACACCGCCGCCTGCCAGCATTATGGAGTGCGAACCTGCGAGGGATGCAAGGGATTCTTCAA
        GCGGACCGTGCAGAAGGGCTCCAAGTATGTCTGCCTAGCGGACAAGAATTGCCCGGTGGACAAGAGGCGCCGCAACCGTT
        GCCAGTTCTGCCGGTTCCAGAAGTGCCTGGTCGTAGGCATGGTCAAGGAAGTGGTGCGCACGGACTCGTTGAAGGGTCGC
        CGCGGGAGACTGCCCTCAAAACCGAAATCGCCCCAGGAGTCGCCACCATCACCACCCATCTCGTTGATCACGGCCCTGGT
        TCGCAGCCATGTCGACACGACTCCGGATCCCTCGTGCCTGGACTACAGCCACTATGAGGAGCAGTCGATGAGCGAGGCAG
        ATAAGGTGCAACAGTTTTACCAGCTGCTGACCAGCTCCGTGGACGTGATCAAGCAGTTCGCCGAGAAGATTCCCGGCTAC
        TTCGATCTCCTGCCGGAGGATCAGGAGCTGCTCTTCCAGAGCGCATCGCTGGAACTGTTCGTCCTGCGGCTGGCCTATCG
        CGCCAGGATCGATGACACCAAGCTGATCTTCTGCAACGGCACGGTGCTCCACCGCACCCAGTGCCTGCGCTCCTTCGGCG
        AGTGGCTCAACGACATCATGGAGTTCAGCCGCAGCCTGCACAACCTGGAGATCGACATCTCCGCCTTCGCCTGCCTCTGT
        GCCCTAACCCTGATCACAGAACGCCATGGCCTGCGGGAGCCGAAGAAGGTGGAGCAGCTCCAGATGAAGATCATTGGCAG
        TCTGCGCGACCACGTCACCTACAATGCCGAGGCCCAGAAGAAGCAGCACTACTTCAGCCGCCTGCTGGGCAAGCTGCCGG
        AGCTGAGGTCCCTGAGTGTCCAGGGACTGCAGAGGATCTTCTACCTGAAGCTGGAGGACCTGGTGCCCGCGCCAGCTCTC
        ATCGAGAACATGTTCGTCACCACATTGCCCTTCTAGAGGCGATCATCAAGCGTATCATCACAACTTGCTTCCTTAAACTA
        GCCCCTAAGTTATGCCTCCTAGGATATACAGAGAAAGGACCCCATAGGACGGACGCAACTAGCTTTAGTAGAACCCTGAA
        ATAAATAAATCTCACAACAGCAAAAACAAAACCGAACCGAACAGAAATGAAGCGAATAGCAGACCCAGGCCATATCTTTA
        GTGTAGAGCTAGGTAGTTAGCCGGACAGCCCCGGCTCCTTCGATAATTACGGACATGCATATTTGAGAGGGGGTTTCCAG
        TGCACAGCCTATGGCTCCTGCGTGACTCGTCAGCACCGCGAGCTCCAACTTGTTGACGTTAATTGTTAAATTGTTTAATT
        TCAACTGTCAAAACCGGAATCAACGGCCGGGCACGCAATGGCAACACTTTCTATCCCCGGACTTCGAAGCCTGCTCAACA
        TTCGGCACTACGGACGGACAAACAACGGACAGAAACAGAACTCACTCTTGCTCTCTTGCCTTTTGCTAACTTCTAGTCAA
        TTGATTTAGGCGAATCAAATAAATAAATAAATAAAATAAGGGCGTGCAGCAGTAGTGTTATATAATTTCTATGCCAGACC
        CCAGCGGTTCTCTTCAAGGAAATCCCCCAATGAGTTGCACAAATTGGGATAAAGTACGATAGCCTATTATTCTTATATTT
        CTTTTAAAAGCTCGAAGATAGATGAGAACTGTGTGGAAATCCACTATCATATCATATAGTTGCTATAAGCCGTGCTTGCC
        CTAAGCTAAGTTAGACCCGCATAAAGTTGATAGCCCAACCAAGTATTTCGGTTATTTCCTAGACTAAGGTCCTAATAGTT
        ATAGGCTAAGACTATTCTGTTCGATTTATCAATGCACCAAACAGTGCACAATGAGAGTATAAGTACCTTCTTGTGATGAT
        TGTGTCTGACACAGAGAGAGTTGCACACAAGCACACAAACTAGCCGATAAGTTACTAAATACGATCTAATATCTAATATA
        TATAATATAATATAATATATATAAGTCCAAGTATTCGGAAATCCAAGAACCCTTGCATAACCGCAGTTCGTACGTTCCAA
        ACGAGAAAAGAACTTTATTTAATCCTAGACCACTCCATCTAAGTTCTCAAAGAATCGTATGTGGATCGTTGGATCTGTCT
        CTCTATATATGTGTGTGTGTTATCTCGATAGAAAACCCCTCTATGTGATTTTGTGATAGATTGGCATTGAACTCTATATA
        TTTATATATATATGTCTATAATATATATACACGCATAAATATATATTTTTATGTCTAACTTTTGTATGGTTTATTTTATA
        CGTACCACTTTTCTTTGATAACAAAAAGTAAAAAACTCGTTAGATAGCAAATATTTCAAAGGTATGTTACGAGGACTTTT
        CAAAGTACCAGTCTTTAGCGACTTTCCAATTAACGTTCGTATTAACGAAAGACAGATTTTCTATGTGTTAAATTGAAGAC
        TTCTATAACTATAACTAAATGCAAGCTAAGAGCAAAAACACAAATCCACAAATCCCCAAAGTGAATAACATATCTCTTCA
        AGCTTTCGAGTGCACGGAACACGTAGAACCGAAACCCAAGTGTTACTAAATCCATTTAATAATCGGCAAGCCGGGGGCGT
        CGGCGTGGTTAATACGTTCTCATTACCTATACAATTTAGATAGATCATTATTAAATTATTGTACATGTAGCACATGAAAT
        GTTCGACAACTAGATTTTGTACCATCTTAAAGAAGAACCTAGGCCAAGCTAAACTAAGTATAAACTATGATCTGCATGCG
        GCTGAGCTGTAGCTATGAGAAATATACCTGCGTGGATCTAAGTGAAATGGGACACTTTGAATTTAGATATGAAACGTTCT
        AAACGCGACGTACTAACTCTCCCAACTGCGAACTCTACCAATTAAGAGAAATTCCCAGAAAATGTGTCAGGATTTCAAAG
        CGTCCCATCTCACTTGAACCCACCCAATCAACAAATACAAATCCTAGGGAAGTTGAGAGGTTCAGCAACCATAGAGCAAT
        ATTTCATAAGAAAACGCACCTTAAATTACCGAAAAACATAGATTAACCTGATCTTGTAACGTTTGGGAGCGATAATAAGC
        CAGGATTAAACAGGAACAGTTAGGTGACCAAATCAGTTCGAAACGAGATGATAGATAGGTTCGGGTTCGAAACCCTAAAC
        GCGATGCCATTTTAGCCGTTACAACATTGGATATCAACCATGCACATGAATATGAATATGAATATGAATATTATAGAGAT
        ATATCTAGCTATAGGAACCTACTTTGTACCTACACGACATGGAAACATCAAACCTACATGCATATTTACACACATATATT
        TTGAATAGAGCGACGACTTTTACAAGTTGCGTACAAAGCTATAGCTATAGCTTGATATGGCCATCCCAGAGCGAGCATAT
        ACATATATTTTGGGTTATTGTTCTTTTGTAATTTTATAAATGCATACATATTTATTGTACTACGTGAATGTCAAGTGTGG
        ATTCATATTTTTGAGATACAGCTACAAAACGAAACAAAAGAAAATAAAACAAAACAGAAGAGTAAACGTGAAATTTTTCG
        ATGAAACAATTTTAAATGAGAACTTTTTAATATTGCTATTAAAGGATATACATATACACACTAACATACATATATATTTT
        ACTATGTAACGGATAGAATTAAGCTAGATGCAGCGCATAAAGCTTTATACAACAAATTGAAAAGCAACAGAAGAAATTGG
        CACAAATTAAATTTATATAGCATAATTAGACGTCCTTCGCAAGATAATGTTATTCGTAATAAGAGCGTCAATCGGTACAT
        CGGGCGCTATTTCCCACTACACCCCCAACCACACAATAGATAACCTAAGCTATGTATGTACATTAGCTATGTATATCCAG
        CCCACTTATGCGCCTACTACTAGAAATGCAGAAAGCAGAAAGAGAGGTGAAACCTATAGACGCTATCACAAATGTCTATC
        TGATAGACATCGGTACTACCAATGCTATATTGCCAGTTGTGTAATTTACTCTTATTTGATCGTTTCATTTACCAGTTAAG
        AACCCAAATCATATAAGTGTTATGATGGAAGAACTATAACTTGCAATTCAATTAACTCTGCAATACGATAACAAGCAAAG
        CGAATCATTTCATTTCGATTTAATCTTTAATTATATATACTTAAACGATGTAAGCCCAAAACAAACGTTTTTTCTATATC
        TGTCTTTTGAGCAAATTAGTTATACGCAAAACCAAACCGTATTTACATAAATGTATACAAAACAAATCGTATATTTTCAT
        TGGTTTGAAATAAATACATAAAAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0301347
        7044
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0080927
        1078
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0290561
        836
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (3)
        Reported As
        Symbol Synonym
        CG1864-RB
        Hr38+R5.2
        Secondary FlyBase IDs
        • FBtr0001312
        • FBtr0001313
        References (4)