Open Close
General Information
Symbol
Dmel\CG2747-RA
Species
D. melanogaster
Annotation Symbol
CG2747-RA
FlyBase ID
FBtr0081818
Feature type
Associated gene
Evidence Rank
Length (nt)
7059
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 11 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          ATTTTGTTTTTGTACTCGGTGCGCGAAGCAAGTGTAAGCGGATCTGGTCTGGACCTGCATCTTTTCCAGAGTTGCGCCTG
          TAATCCGCTCTAATTCGGTTTTATTTTTTCGCAACTTATGCTACATCGAGTGACAAGAATGAATTGACCTAGTGTAATTG
          AAAGCAAAACAGTAATATTAAACAAAATCCATTGGAGCAGTTAAAAACGTGTGCTAAAAGTGCTTTTGTGGAAGTGTTAT
          CGATTTGTGTGAAAGTTGCAGGCTGCTGCAGATTGGCGAGAGAAACGGCGAAGAAAGTTTTCTGGAAATGTGAAGACACA
          GCAAATCACAACAATGGAAAACTTAAACTTTGCACGCACGCCGCAATTTCTGCGCAAAGTTATCTCCGAGGCGCGCAGAT
          CGTTTATAAACAGCGACCATTTTTCCGCCTCATCGACAAGGGGACGCTCGGAAACTGAGGAGGAGGCTATATCCGAAATG
          GAGCTGGCCCACACTTTGATCCTTAATGAGGATGCTCTCAAGCAGTTGCCCGAACACAAGCGGCCTGTGTTCGAGTTGGA
          ATGGCTGCGCTACTTGGAGAAGGCCCTGCCACTGGTGTCCAAAGCGGAGATCAAGGCGAGCCAGAAGAAGCTGGTGCAGC
          AGCTCTCTGAAAGAATCCAGGGCGCACCAGGTCCGCCCATTCGTAAGCTCATTGCTAGCGCGTTGGCCACGCTATTCTCC
          GTTGGTGACACCTTCATGCTCTTCGACACCGTCAACGCCTGCAATGACATCCTGAAGAACAAGGACGACTCGCCCAGCTA
          CTTGCCCACAAAGCTTGCCGCCATTTGTGTGCTGGGCTCTATGTATGAGAAGCTGGGCAGGATGATGGGCCGCACCTACG
          AGGATACGGTGCAGATCCTTATTCGAACGCTTCGCAACGCTGAGTCGCAGGCGCGGATTGAGATCATGCACACGCTGGAG
          AAGGTGAGCGCTGGCATGGGCACAGCCATTGCCAACGTGCACAAGGATATTTACAAGGCGGCCAAGCATTGCCTGTTGGA
          CCGAGTTATGGCTGTTCGAGTGGCTGCAGCCCGCTGCATCCTTAAAATGATATACAGTGCACCATTCCTGTACCAAACGG
          AGCTGGAAAGCTTGGGAACATTGTGTTTCCGAGCCTTCGACGGCAGCAACTATGAAGTGCGATGTGCGGTAGCTCAGCTG
          CTGGGAACACTTCTAGCCTATACTCAACAACTGGCAGAAGCGGCAACAAGCAAAAAGAAACAGGGACAAGCGGTGGCTAT
          TCAAGCGGGCAAGGGAGCTACCCAACGCTTGGTTTCCCTGGATGAAGCTCTGGGCATTCTCATGTCAGGTTTCCTTCGTG
          GTGGCGCATCTTTTCTCAAGGGTACCGGAGAGATTATCAAAGGCAGCTCAGGTGTCAACCGTGAGGTGCGAGTGGGTGTA
          ACGCATGCATACGTGGTTTTCGTGCAATTCATGGGCAGCGTTTGGTTGGAACGACAGTTAAGCACATTTCTGGCACACGT
          TTTGGATCTCGTGGCCAATCCAAAGGCAGCGTGCTCCCACGTAGATGCAGTGTATTCACGGAAATGCATTAGCTTTATAC
          TCCGATCAACGATTGGAAAGATGCTAGGCGAGAAGGCGCAGAGCGCTGCCTGCAAGGAACTGGTCCATCTGGTAGCCAAA
          CAGATGAACTCAATTGACTTCAATCCCGAGAACGCCAAGGATTCTAATCAAGAAACACTGTTCAGTCAGCACCTGCTGGT
          GTGTGCCCTCCAGGAATTGAGTTCTCTACTTATTGGATTAGGAACCACGGCCCAGAACTTGTTGGGAGATCAATCCCTGC
          AAGCGATCGATGCTACCTGTGCCGTATTGGTACATCCCTGCGCCGCTGCCCGTTTGGCTGCCGCTTGGTGCTTACGATGC
          GCTTGTGTGGCGGTTCCTGGGCAAATCACGCCACTAATTGATCGCTTTGTGGAGGCCATCGAGCAGATGCGATCCTCGCC
          AGAAGCAATGGCCGGATATAGCTGCGCTTTGGCGGCAATTTTGGGAAGCGTTCGGTACTCGCCATTGGGCATACCCCACA
          CAAAGGGAAAGGTCGTGTTCAACTGTGCGGAGGAACTGCTGCGATCTGCTTCCCAGAATAGCCGCATGTCGCTGCACCGT
          ACCCAGGCCGGCTGGCTATTAATTGGAGCTATAATGACTTTGGGATCGCCGGTAGTCAAGGGCTTGCTGCCGCGAATGCT
          GCTACTGTGGCGGAACTCTTTCCCGCGGTCCAACAAAGAGCTTGAATCGGAAAAGGCGCGCGGCGATGCCTTTACCTGGC
          AGGTGACCCTAGAGGGCAGAGCTGGAGCTCTTTCTGTAATGCACAGCTTCCTGCTTAATTGCCCGGATCTCCTGAACGAA
          GACATAACCAGACGACTACTCACCCCCATCGAAAGCGCCCTGGCCATGTTGGTCAACTTGGCATCTGTCCTAAAGAGCTA
          TGGAACCCAGCTAAAGGCACCGGCAGCTATGGTGCGGCTTCGTCTCTTTGAAACGCTGACGCTGCTGCCTGCTAATGCGC
          TAGAGGCCTCCTATACCCATCTTCTTCGCATGCTCGTCTCGGAGTTTACTCTTTCGGATAACGCGGCCAACACTACAAAC
          TCATTGTTGCGGACGCTTTGTCATGGTGATGATTCGATCATACTGGGCACCTGGCTGCAAGAAACTAATCATCGCACCAT
          TGAGGATCAGATGGAGCCCAATCGCAAAGTCGATGGCGAGCATCTGCAACCCAATAGCGCCGCGGGATCTGGCGCCTTAG
          AGCACGATCCATGCTGTTTGTACCGTCCCAGGTCTGCCCAAGGCAATGGATCCAGCTCGAATGGTTCATCAGCAACATCT
          ACTGGTGGAAGCAACGGCGGTGGAGGAAGCAACATTCAGCAGATCAGCAAGGCCCAACAGTGTCCAGGACCATTGCCACT
          CGGGGTAGCAGTGATCGATATGGCAGTGACTCTGTATGGAACCATTTTTCCCAAAGTGGCAAACAAGCATAGGCTGCAAA
          TGCTGGAGCACTTTACTGAGTGCATTCGCCAGGCCAAGAGCAGTCGCCAAGAAGCCGTTCAAATGAATATCTTTACGGCT
          CTGCTATGCGCTCTAAAAAATCTGACAGATAGCAAGACAAGCCTAGGACAGGAGGATGTTCGAAAGAGTGCCACGGCATT
          GATAGTTGCTTCGCTGACGAGTGCCAACTCTACCATACGGTGTGCGGCTGGAGAGGCCTTGGGTCGATTGGCCCAGGTCG
          TGGGAGATTCTCATTTTACCGCGGAGTTGGCTCAAAATAGTTTTGATAAACTAAAGTCTGCCAGAGATGTGGTCACGAGG
          ACGGGACATTCACATGCCCTGGGCTGCCTGCATCGCTATGTGGGTGGCATGGGCTCGTCGCAGCATCTGAGCACCAGTGT
          ATCTATCCTTTTGGCCTTGGGTCAAGATAGTGCATCGCCAGTGGTACAGGCTTGGTCGCTTTATGCTCTAGCGCAGATTG
          CCGACTCTGGAGGACCAATGTTCCGCGGCTACGTGGAGGCAACTTTGACGCTGTGTCTGAAACTTTTACTTACCGTACCC
          CACGCTCATGTTGATGTACATCAGTGTGTGGGCCGTGTAGTCAATGCGTTGATCACCACCGTGGGACCGGAGTTGCAAGG
          AGGAGGAGGCGCAGTGGCCACCATGAGAGGATCATTCCTCTGCTCAGCAGCTCTTCTTCAATCACATTCGGATCCTCTTG
          TACAAGCTGAGGCTATTGGCTGCCTGCAGCAGCTACATCTTTTTGCCAGTAAATCTCTGCAACTAGAGGAGTTGGTACCC
          ACGCTGGTTGGAATGCTAGCCTGTAACTATTTCATACTTCGCAAGGCCTCCGTTTCCTGCCTCCGTCAGTTGGCCCATCG
          AGAAGCTAAGGAAGTGTGTGAATTAGCTTTAACTATTAACGCCGAACAACTTCCGGATTTGGTAATTACGGAGTATGGAC
          TTCCAGGGCTGCTTTTCTCACTGCTCGACACAGAAACGGATGCCGAGATGCTGAGAAACATTCACGATACACTCACATCA
          ATGCTCCAAATGCTGGCTGCAGATAATCTCAGCTCCTGGTTGAGTCTTTGCAAGAATGTGTTAACCGTTGCTGTGGAAGG
          AGGACTAAATGATGATCCCGCTGCTGGGGAACAAAGCAAGAGCAAGGAGGCTGGTGGAGAAGATGATGAAGAGGACGAGG
          AGGAAGAGTATGCTGATGATGTAACAGAATACCGAGCAGAGGAGAACACATCCACCCATCCAGCAGTGCAGCCAAGGTGG
          CCCACTCGTGTTTTCGCCGCCCAGTGCGTGCGGCGGATCATAGCCAGCTGTGAGGCTGCCAGTTCAGTGCACTTTGATCT
          CCTGCAGGCTAAGGAACAGCAACTTATTCGTTCTCGCGGAGATTACCTCATCCTCCATTTAGCGGAACTTATTCGAATGT
          CCTTTATGGCTGCCACCTCGGACTCGGATCAATTGAGATTAGAAGGATTGCGCACCCTGCAGGAAATAATCGATCGATTT
          GCTAACGTTCCGGAACCGGAGTTCCCTGGTCACCTACTCTTGGAGCAGTTCCAGGCTCAGGTGGGAGCTGCCTTGCGCCC
          TGCTTTCGCGCCGGATACCCCCTCCCATGTGACAGCTGCTGCTTGTGAAGTTTGCTCAGCGTGGATTGGATCTGGAGTGG
          CTCGCGACATAGGAGATCTAAAAAGAGTTCACCAGCTGTTAGTCAGTTCCCTTGATAAGCTTTCCTCAAAAACCAACAGC
          ACTCAGTTATATAACGAATCCATGGCTACTTTGGAGAAGCTAAGCATTTTAAAGGCGTGGGCAGAGGTTTATATTGTGGC
          CATGATAGGAAATGGAAAGGCTCCGGCTTCCCTACTGAATCTCCAATCCCAACAATCCGGCTTTCAATCCTTAACCAATC
          TGGAAACGGACTCGGATGTTCCTGACAGTAGGGGTGAAAGTCTTTTAGGATTAGTGCAACCTGAGCTCCACAATCTTTCA
          ACACACTGGCTGAGTGCTATGAAGGATCACGCCTTGCTGCTTCTACCTGCGGAGTTCCAATCCCAACTACCGCACGACGG
          AGGAGCCTTTTACACCACGGACACCATTAATTCGTCAAAACCACATTACATGACCAGTTGGCCCCCAATCCTCTATGCCT
          CCGCACTATGGTTAAGGGATGAAGGGTTCGCCCGTCATCTAGACACAAGTGAAGCCGCAGCTGAGTCCAACAATAATCAG
          ATCACTCATGGATCTTTGTCAGCGGATCGCTTCCATATGATCTTCGGCATCTGCATGGAGGCGCTCTGCAGCATGAGAAG
          CTCTGAAAGGCCGAGAAACATTGTGAGCTGCCTTCGCTCACTGCACAGCATCTTTGATTCTGATTGGGCTAGGAGGCAGT
          TGGTCAAGGATCGGGCTTTAACCATTGAACTCTGTCATGTTCTACATCGTCAGATACTGACGAGAGATGAATTACTCGTA
          CAACTTCTGTGCGTAGAAATTTTAAAGCAAACAATCCGCGCTGCTAGGGAAGACTTAGAAAGAAAACGGGACGATAATGC
          CAATTCTGAGGACGGAAAGGGTGGAGAGCGACATGGAGAAGATGATTCTATGCAGCCAGGAAGCTCGCATGTCTACGCCG
          TTCTGGAGGTTTGTCTTTGCCTATTTGTTCGCCAAATACCTACGATGAATCCCACGAGGCAGGGAGCTGGTGGCTCCGGC
          TTACAGCTGGACTTTGCCTATGCCAAAATGGCCACTGGCTCGTCATTCTTCTCGGTGCTCGGCGATGAAAACGGCCTGCT
          AGTATCCAGCGGACTGCAGTGCGTCGAACAGTTGATGGATTTGTGTACTCCCAAAGGTGCCCTTGCAATCCTGCCCACCG
          TCCTGTATATGACAACCAGTATCGTTAAAGAAATCGCCAACAAGTCGGCCATAGATAGTACTATCTTGGCAAATACGTGT
          GCTGTGAAGTCTGCCCTGCAGTGCTTGCGATCCGTTTGTGTCCACAAGTGGGCTAAAGTAGAGGAGACAACCGAGGAATG
          GCAACAGTTACTGCAAAGTGCACTGGCCACCATTGTGGATCTCACCAAAACGGCTGGCGATAACGAGGAAAGGAAAGTCG
          ACGAGGTCACTATGCTGCTGGCCATCACTGTTTTTATTCTACATACTCCCGCCTCCGTTGTGGCTACACCTTCATTGCAA
          TATCCATGCATTAATCACTTCCGGCAGTGCCTGCAGTCGGAGAACCTCTCGGTGAAGCTGCGCTGCATCGAGACCACGCG
          ATCGATCTTCGCTCGGGCCGAATTGAAGACGGCAACACCCTACATCCACGCACTTGCGCCTAGGATAATCGAATCGTTGT
          ATGCGGAGTCCAGCAAGGTGCCCACAAGCGAACTGGAGCTACAGGTCACCCTGGAGAGCATCGTTACCGTGGAGCAGCTT
          ATAGACTTGTCGGAGCCGCAGAACCATATTCAGATGCTGACTCTGTTGGTCCCTGTGCTCATTGGCTTCCTAGCGGAACC
          CAGTCGACTCCGGACGCTGCCAAAGTATCAACGGCAGCTGCACGACCAGGCGCTGCAGTGGCTACTGAAGATCGGTCCGA
          AATATCCGCAGGAGTTTAAGGCCCTGATGGGTCAAACACCGGAACTGCGACAAAAACTAGAAGCGGCCATTCGCAGCCAA
          CAGCAGTCGATTAACATTGCCCAAAAAGCAAGCGAGGCGCAGAGGAACCTGCTGGCCAAGCCGCAGAAGCCTACGATCAA
          GCTGAAGACGGATTTCAGTAACTTCCAATGAGCGCCTCCCCCGGGAATCGAACAAAATAGTTCTCAAGCTGCTAGTGCTA
          TCATAAAAATGCTTTGTAATACATTGTTACCGCATGAACAATAGGATGGATCGGTTCTTTTTATATTGAAAATAAGGTTT
          AGACAATTTTGCTCTAATAACTAAATATCCGGGATAAAAGTTTTGAAAGGATTGTAAAACGGCAACTAAAATATACATTA
          GTTTTTTTGACTGCTTGTG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0081817
          7049
          FBtr0300916
          7026
          FBtr0300917
          7016
          FBtr0335229
          7289
          FBtr0335230
          7322
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0081308
          2165
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0081307
          2117
          FBpp0290138
          2154
          FBpp0290139
          2106
          FBpp0307216
          2161
          FBpp0307217
          2172
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG2747-RA
          Secondary FlyBase IDs
            References (2)