Open Close
General Information
Symbol
Dmel\Pnn-RA
Species
D. melanogaster
Annotation Symbol
CG8383-RA
FlyBase ID
FBtr0082126
Feature type
Associated gene
Evidence Rank
Length (nt)
1202
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 18 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CTAGTAACCTCTCATCCCTAAGTATTGTTTTTTTACTTTTATGAGCATCTAATTGTACCGACTTAAGTAAAATAATTAAT
      TAAACAAAACCTAACTGAAACGTGGGAACAATGGTGAATGACTCTGGTCTATCGACAGTGGACGACTTGGAGCAAAAACT
      GAATTCGGCCAAGCAGTCGCTGGTGATCCTAAATGAAAACATTCGCCGCATTGCTGGTCGCGTCCCCAAGGAATCCCTGC
      AGAGATCGGAAAAATTCAAATACACCCAAGATGGCAAGAAGAACGAGCACAATGGGGACCGACCGTTCCCCCGAAATGCA
      ACACCCGGTGGGGTCTTCAAAGACAAGCGGCGAATGTACGAAAGCAAGAATCCAATTTCCCGTTTCCCAATCGAAGAAAA
      CGAGGGTCGTCCGCCACGGATTAACTCGCGGGTCATCCGGGAGATGCCAACTAAAAAGGAGATTGTCGAGGCACAGGGCA
      CAGACTCTGAGTCGAGGGCCAGGAATCGCAGGATGTTCGGATCGCTGTTGGGAACCCTACAGAAGTTCTGTCAGGAGGAA
      TCGCGACTGAAGAGCAAGGAGGATAAAAAGGCTGAGATCGATAGGAAGGTGGAAAAGCAGGAACTGCAGGAAAGAGCGAT
      GCTGAGGAAACAGCGTGAAACACTATTCTTAGATAGGAAAAAAAAGCAATTCGAGATCCGTAGATTAGAGTACAAAATGG
      CCAGAATGAAGGACTTCAAGGTCTGGGAAGCAACTATGTTGAATGCGAAAAATAACATCCGAACAAAAACGAAACCACAT
      CTGTTCTTTAGGCCAAAAGTGCATTCGCCTAGAACGGAAAAATTGTTGAGCAAAAGCAAAAGTGAAGCTGATGTGTTTAT
      AGAATTCCGGCGCGAAGAATTGGAAGTTGAGCTTAAAAACTTGGAGAACATGAACTTTGGGAAGATGGAAGACGATACTG
      CAATAGACGAAAGTTTCTATGAAGAGCCTGACGACGAAGAGCAGTTGGATAAGTGTAAGTAAACTTCAGTTTGCACTAGG
      GCTTGAAATATGATCGTGCGGATATCGCTGTGTAGGGCAATTGGGTTTCAATTTATAAAACTTATTTATGAAACTTTAAT
      TTATAATACAAAAACCAGATCTTAAGCAAATAAATTACAATGCGGTGATTACATTTAAAAGTTATATCGTATTTATCAAC
      TC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0113210
      1659
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0081604
      303
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0112122
      307
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG8383-RA
      Secondary FlyBase IDs
        References (2)