Open Close
General Information
Symbol
Dmel\Art4-RA
Species
D. melanogaster
Annotation Symbol
CG5358-RA
FlyBase ID
FBtr0082150
Feature type
Associated gene
Evidence Rank
Length (nt)
2701
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 63 )
Sequence
TATTTGTTCCAGCTCTAGCACTTTTTGCAAAAAAGAACGCATGTTCCGTGTGAAATCAATACGAAATCAACAAGAGCGAT
CGATTTTGAGTAATCGTCCGAGTTGAAAAGCAGCGCACTATATAGTTCCCAGCGCCAATTAATCCAGCTGCCCGAGTCAC
CAGCCATTTTGTGTGTGGTGGAAAATTTTGCAGATAGAAAAAATTGCGCGTCTGTCTGTCTGCATCTGCGTATCTGTGTG
TGTGCGTGTGCTAGAGTGTTTGTGTGTGTGCGTGCGTGCGTGTGTATAGCGAGGTCTACATTGTCAATTAACAAGGGAAA
AAAGACGCTTGTGGTCCTGCTTTGTTCCTTTGCCTCTTTACCCTCCAAAAAGCCAGCCAACATGTCCAGCCTGCGACCCG
AGGAGGCCCGAAAACTGGCCACCGCCGCCTCCGTTTCGCCGCTGAGCAATTGCCAATTTTGCGGCGTGGTAATCAGCTCG
ATTGCCGACGAGCAGAAGCTAGAGTTTACCAACAAATACAAGGGAAGCTGCACGCTGCTCTGCAGCTACGATTCCCAGGG
TGTCGTCCTCCGTGTTGTGTCAGACGACGACCGGAGCCACGTGCTCAAGGAGTACATGATAGCCGCCGATACGGATGCCG
CCCAAATGGGACGAAGGAGTTATGCCGTTTCCCTGGACGCCGACAATCTAGTGCTGAGGTTTGCCAGCGAGCAGGACCAG
CAGCTCTTCCGCAAAGTGGTGGAGAACGTGAAGCACTTGAGACCCAAGTCCGTGTTCTCGCAGCGCACTGAGGAGTCGTC
CGCCTCGCAGTACTTCCAGTTCTACGGCTACCTCAGTCAGCAGCAGAACATGATGCAGGACTATGTAAGGACAAGCACGT
ATCAGCGGGCCATTCTAGGCAATGCTGTGGATTTTCAGGACAAGATCGTCCTGGATGTGGGCGCCGGCTCGGGCATTCTC
TCCTTCTTTGCCGTGCAGGCGGGAGCTGCCAAAGTGTACGCCATTGAGGCTTCCAACATGGCCCAGTACGCCCAGCAGCT
GGTTGAGTCCAACAATGTGCAGCATAAGATCTCTGTGATACCGGGGAAGATCGAGGAGATCGAGCTGCCCGAGAAAGTGG
ACGTTATCATATCAGAGCCTATGGGCTATATGCTGTACAACGAGCGCATGTTGGAGACCTATCTGCATGCCAGAAAGTGG
CTCAAGCCGCAAGGAAAGATGTACCCCACGCACGGCGACTTGCACATAGCACCCTTTTCGGACGAATCGCTCTACTCGGA
ACAATATAACAAGGCCAACTTCTGGTACCAGTCGGCGTTCCACGGCGTTGACCTTACCACGCTGCACAAAGAGGGCATGA
AGGAGTACTTCCGACAGCCCATTGTGGACACCTTCGACATCCGCATATGCATGGCCAAGTCGGTGCGGCACGTGTGCGAC
TTTCTCAACGATAAGGAGGACGATCTGCATTTGATAAGCATCCCCCTGGAGTTTCACATTCTGCAAACTGGCATCTGCCA
TGGGCTGGCCTTTTGGTTTGATGTGGAGTTTAGCGGCAGCAGCCAGAATGTGTGGCTCTCAACGTCGCCCACAGCGCCTC
TGACACATTGGTATCAGGTTCGCTGCCTTCTGCCCATGCCCATCTTTATTAAGCAGGGCCAGACGCTGACCGGCCGTGTC
TTACTGGAGGCCAATCGGCGGCAGTCGTATGACGTGACCATCGACCTACACATCGAAGGCACGCTGATTTCGTCGAGCAA
CACCCTGGACCTTAAGAATCCGTATTTTCGGTACACGGGGGCCCCGGTCCAGGCACCGCCGGGGACTAGTACCCAAAGTC
CATCTGAGCAGTACTGGACACAAGTGGACACGCAAGGATCACGCAATTCTTCAAGCATGCTAAATGGAGGGATCAGCGTG
AACGGAATAGGCGAAGGCATGGACATCACTCATGGACTTATGCATCCGCACTAGGGGGGCGGTGGATCGAATAACAATAC
ATCTTTCTGGGAATTCCCTTTGCTCTAAGTCCGCTCACTTTCTACGCTTGATCCTAATTTTGCCAATTTTTGTTTTGTTA
CAGTTTATGATTAGGTTATTTATTGAAAAGTGTAAAATATTTTTATCTATTTTCGAAAGTTAGTTCTGTTCTGTTTTGCA
TACCTTTTAACAACCTCTTTCCCTATCGTGCTATACTTATCCTCCCTTCTCTTACCCATTTAATCGATCGGACAAATCGA
AGGAAATCCAGCATCCCAGCAAGTAACCAACATACAAACAATCAACAAATCAAGGCAGACTAATGTAGTTGTTTAGAACA
CGCAGCATATTAATAAGCCTAAGCTAATTTAAGCCCATAGTAATTAGAGTTTTTAACGTATGTGAATTGTAATACCGATA
TTTAGCCCGCACGGGACTGCGCTTCAGGAAGTTTATTAGTTAATATGCCGATTGCCAATTGCAGATTTTGCCGTAAGCTT
TGAACAAACCAACAAATTCAGATTGTACTGTATCTATTATGTGTGTTATTATACTATATATTGTGTGTACCTCCAGCTAG
TTTCAATTTTTGTACTTGTCGACCGTGTTTATGTTTAGTTCGTTTCAAAATGTAAGAAATTGCTCATAGGATTTAGTGCT
AAGCTACGATATCATTACTAAAGGCCGACCTGGGTCGAGAGATTATACTTATACCCCCAAT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0333687
3071
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0081628
530
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0305840
530
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (3)
Reported As
Symbol Synonym
CG5358-RA
Carmer-RA
Secondary FlyBase IDs
    References (2)