Open Close
General Information
Symbol
Dmel\pug-RA
Species
D. melanogaster
Annotation Symbol
CG4067-RA
FlyBase ID
FBtr0082265
Feature type
Associated gene
Evidence Rank
Length (nt)
3098
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 80 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
    Sequence
    TCAGTTGCATAGCGCGAGCCGAGTTGGCGTGGCTAGTGAGGCGGTACTTTCGGTCATCTGGACTAAAAAACTTTACGGGC
    TTGCGTTTTTTCAGCGGAGAGTGGACAGCAGAGCCGGCTATCAAGATGAGTGGGGCCAAGATCATATCGGGCACGGCGGT
    GGCCAAATCCATTCGCGAAGAGCTGCGTAACGAGGTGACGGCTATGAGCAAGCAATTGGCGGATTTTGTGCCCGGCTTAA
    GGATTGTCCAGGTTGGTGGACGTGAGGACTCCAACGTTTACATCCGCATGAAGATCAAGGCGGCTACGGAGATCGGTATC
    GATGCCGCCCACGTCCAGCTGCCCCGATCCATCACCGAGGTGGAATTGCTCGATAAGATAAACGATCTGAACGAGGACCC
    CCGGGTGCACGGCATCATAGTGCAAATGCCCCTGGATTGTGACACACCCATCGATTCGCACCGAATTACGGACGCCGTTT
    CCCCGGAGAAGGATGTTGACGGCTTGCACACGGTTAACGAAGGTCGCCTGGCCATCGGTGACCTTGGTGGTTTCCTGCCC
    TGCACTCCTTGGGGTTGCCTGGAGTTAATTCGCCGTTCTGGAGTAGAGATCGCCGGAGCCAGGGCTGTGGTTCTGGGACG
    CAGCAAGATCGTGGGCACTCCCGCCGCCGAACTGCTCAAGTGGGCCAATGCCACGGTCACAGTGTGCCACTCAAAGACCC
    GCAACCTGGAGGAGATCACCCGAAGTGCAGACATTCTGGTGGTCGGAATTGGAGTGGCCGAGATGGTTAAGGGATCGTGG
    ATAAAGCCCGGAGCAGTGGTCATCGATTGCGGCATCAATGTGAAGCCAGACGCCAGCAAGGCCAGTGGCAGCAAGCTGGT
    CGGGGACGTGGACTACGCGGAAGCTCTCCAAGTGGCAGGACATTTGACGCCAGTGCCCGGCGGCGTGGGACCCATGACGG
    TGGCCATGCTTATGAAAAACACCGTGCGATCTGCGGCCCGATTCCTTGAGCGTCTTGCTAAGAGCCAGTGGGCCCTTCAA
    ACGCTGCCCCTCAAGCCCCAGCGTCCCGTGCCCAGCGATATTGTGATTGCCCGTGCCCAAAAACCGAAGGACATTGCCGT
    GCTGGCCAAGGAGATTGGTCTGGAAGCTCGTGAGGTTTCCTTGTACGGAAATAAGAAGGCCAAGATTTCACTGTCAGTGT
    TGGAGCGTCTGAAGGACAAGGAGGTGGGTCACTATGTGGTTGTAGCCGGTATGACACCAACGCCTTTGGGTGAGGGTAAG
    ACCACCACACTAATGGGCTTGGTCCAGGCTCTCGGCGCGCACAAGCTGAGAAACACCATGGCTGCTCTGCGACAGCCCTC
    CCAAGGTCCAACCTTTGGCATCAAAGGAGGAGCTGCTGGCGGCGGATACGCCCAGGTGATTCCCATGGAGGAGTTCAATC
    TCCATCTGACAGGAGACATTCATGCGGTATCGGCAGCCAATAACTTGCTGGCCGCCCAGCTGGACACCCGCATCTTCCAC
    GAGAATACCCAAAAGGACAAGGCCTTGTATGACAGATTGGTGCCCGCGATCAAGGGTCAGCGGAAATTCAGCCCCATTCA
    GCTACGCCGGCTCCAGAAATTGGGAATCACCAAAACCGATCCCGATACCCTTACCGCTGACGAATACGGACCTTTTGCCC
    GGCTGGACATCGATCCGGACACGATTATGTGGGAGCGTGTGGTGGACATCAACGATCGGTACCTACGCACCATTACCGTT
    GGGCAATCGCCCACTGAAAAGGGTATTTCGAGGGAGACCCGGTTCTCCATCTCGGTGGCCAGCGAGATCATGGCTGTGCT
    AGCACTATCCCGAAGTCTGGAGGACATGAAGCAGCGGCTGGCTGACATGGTGGTGGCATTCGACAAACGAGGCAAGCCCG
    TAACCGCTGACGATTTGGGTGTCACCGGTGCCCTGGCAGTTCTTTTGAAGGACGCTCTCGAGCCGAACCTGATGCAGTCG
    CTCGAGGGAACTCCAGTGCTGGTGCACGCTGGTCCCTTTGCCAACATCGCCCACGGTTGCAACTCGATCATCGCTGATGA
    AGTCGGCCTAAAGCTGGTTGGTAAAAATGGATTTGTCTGCACGGAGGCCGGGTTCGGATCAGATATTGGCATGGAAAAGT
    TTTGCAACATTAAGTGTCGGACATCCGGTCGCAAGCCGAACGCCATGGTGCTGGTAGCCACTGTGAGGGCCATCAAGATG
    CACGGCGGCGGAGCTCCCGTCACTCCCGGAGCCCCCTTGAACAAGCAGTACACCGAGGAGAACTTGGAGCTCGTCCAGAA
    GGGTCTGCCCAATCTGCTGCAGCACATCGAGAACGGAAAGGCCTTCGGCATGCCAGTGGTGGTGAGCCTTAATGCTCATT
    CAGCAGACACCCCGGCGGAGCATGAGTTGGTCAAAAAGGCTGCTCTGGAGGCAGGTGCATTCGCCGCCGTAGTCTCCACT
    CACTGGGCGGACGGAGGAGCCGGAGCCGTTCAGCTGGCCGATGCCGTGATCAAGGCCTGCGAACAGGGCAATCAATTCCG
    ATTGCTCTACGATCTGGAGCTGCCGCTGGTGGATAAGATGAACAAGATCGCTACGACGATGTACGGCGCTGGAAAGGTGG
    TGCTCTCGCCGGCGGCTGAGGAGAAGGTCAAACGCCTGACGGATGCGGGTTTTGGCAATCTACCTATCTGCATGTCCAAA
    GTCTCCGGCTCCTTCACCGGCGATGCCAAAATCAAAGGCGCCCCCAAGGGCTTCACCCTGGACGTTGAGGACGTATATGT
    TTCAGCCGGAGCCGGCTTTGTGGTCGCCATGTGCGGTGAGGTCACCAAAATGCCGGGTCTTCCCACCCGCCCGGCGATCT
    ACGATATCGATCTGAATACGGAAACCGGAGAAATTGAGGGCCTATTTTAGACGGCAACCTGGACAAGGGAGAAGATTCCT
    AATAACTTTCAACGCCTTTTCACATCTAATTCCAGAGTAGTAACAAATTTATCGTTTTAACTTGTATATAAATGATATAG
    AGATAAGATTTAAAAGTCGGTAAACTAATATACATTTCTGACGATTTGAGTTTTCTTT
    
    Other Products of this Gene
    Other Transcripts
    Name
    FlyBase ID
    Length (nt)
    FBtr0082264
    3273
    FBtr0082266
    3044
    FBtr0100144
    3160
    FBtr0305662
    3118
    Polypeptides
    Derived from THIS transcript
    Name
    FlyBase ID
    Length (aa)
    FBpp0081742
    934
    Derived from OTHER transcripts
    Name
    FlyBase ID
    Length (aa)
    FBpp0081741
    968
    FBpp0081743
    934
    FBpp0099494
    968
    FBpp0296942
    965
    Comments

    Transcript terminates at site supported by polyadenylated cDNA.

    External Crossreferences and Linkouts ( 1 )
    Crossreferences
    RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
    Synonyms and Secondary IDs (2)
    Reported As
    Symbol Synonym
    CG4067-RA
    Secondary FlyBase IDs
      References (2)