Open Close
General Information
Symbol
Dmel\CG10096-RA
Species
D. melanogaster
Annotation Symbol
CG10096-RA
FlyBase ID
FBtr0082603
Feature type
Associated gene
Evidence Rank
Length (nt)
4716
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 1 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CGCAGTGCAAAATGACGAGTGAAATTATAAGTTTTTATAAGGACAAAACGGTGTTTATAACCGGAGGCACAGGATTACTC
          GGCAAAGTGGTCGTAGAAAAGCTATTAAGGGCGACGGATGTGAAACGTATATACTTCCTGGTTAGAACCAAGCGGGGTGA
          GAAAATGGAAGCACGATTTGAGTCCTGGAAAAAGGATCAGGTGTTTGAAGTTCTACTAAACAAAAATCCACTTGCGCTGG
          AAAAGATGACTCCGATTTCGGGTGACTGCTGTGCCCCGGACTTGGGCATCAGCGAGACAGATCGAAGGATACTGGCCGCG
          GAGGTGCAGGTGCTCATACATGGAGCCGCTTCGGTTCGATTCGAGGAGCCACTCGAACATGCAGTGGTCATCAACACCAG
          GGCAGTGCGTCTCATTACCCAGCTGGCGAAGGAAATGCGACTGCTCGAGTCCTTCGTCCACGTCTCAACAGCGTTCTCCA
          ATTGTGTGGTGGATCAAATCCAGGAGCGATTCTATCCGGAACACCTGTCCTGTCCCGTTGACAAGGTGCTTGACATGCAC
          AATTCGGTCAGCTCCGAAACGTTCGAAAAGATGGCACCAGCCTTGATTGGAAAATTCCCAAACACATATACCTACACCAA
          GGCACTGGGCGAGCAGGTGATCCAGGAGGAGGCGAAGGGTTTGCCCGTAGGCATCTTTCGACCAGCGATCATTTTATCCA
          CGTTCAAAGAACCAGTGCAAGGATGGGTTGATGGCCTGCAAGGGCTGATAGCCATGATATTTGCCACTGCGTACGGGTTT
          GTTCACTTATTGCTGGTTAATCTGAAAGTTAATGCTCCCATAGTTCCGGTCGACTACTGCGTCAACGTGGCCATCGCCTC
          AGCTGTCCAGATAGCTAAGATCTCAAAGCAAAATAAAAATGGACCGCCGCCCATTTACGCTTTCACGCCCAGCGAATCAA
          ATTTGGTGACTTATGAAGATCTGGCTGGGCTATGCTATCAAAATGGTCTGGAGGTACCAAATGCGAAAATGATCTGGTAC
          CCGTTTACCCATTGCACCAGATGCCCCTATCTGTATAACATTGGTATCTTATTCTATCACATGCTGCCTGGATATTTGCT
          AGACATTGTGCTGCGTCTGAAAGGCCAAAAGCCGATGATGATCAAGAGTTATCACAAGGTCCACGAGGGGATGCGGAGTT
          TGCTGCCCTTCTCTAGGAAAACCTTTACCATGGACATGAAAAATACCAACGAAATGTGGCAGTCCATGTCGCCGGAGGAG
          AAGGAGATGTTCAACTTTGATATGTCAACATTGAACTGGAAGGAGTATTTTACGTGTCTCATGGACGGAATACGATTGTA
          TTTGTTTAAGGACCTCCGGACGCCGGATTCCGTTGCCGAGGGAAAGCGGATTTTAAAAAGGTTTTATGTATTGGACAGGA
          TTCTTAAAACTGTATTAGTTACATTATTTGGTGGCTTTATTTGGTTATTAATCACAAATTTAGTGCCACTACTGTAACTA
          TTTTTTTTTATCTCTTAAATGAAATTATCTCCAGAAAATAACTGTAAGCCACATTGGTTTTTACAGGTTTTATGTATTGG
          ACAGGATTCTTAAAACTGTATTAGTTACATTATTTGGTGGCTCTATTTGGTTATTAATCACAAATTTAGTGCCACTACTG
          TAACTATTTTTTTTTTTTTAATTCTTAAAACATGCACCGGGTTGAAGGCTAAATAAATAATGAGTTTGTTCTTGATGGAT
          CTCAAAACAAAAATTTTTATTAATGTGTTTAGGGGTGTATTCGGCGTAATAACTAATATTGGATTCTTGAAAAGTCTATT
          AGAAATGTGAAATGTAAAGGAAGTTTAAAGTCGAATTTGTTCTACGCGGTTCGAGTATCTGTTTATAAAATATTCATACG
          CACCAATTGTTGCGCAATTGTTTGGCAATCGAAGCTTGTTCGAACTATATAATTACAAAATAGCGAATAAATTAACACGT
          CTGCATTTCGATTTCCCATATAAATTAGCCAGTCAATCGGCCACTCATTATCCAAGCACATTCATTAGGCTCGAGCCAGA
          CTCACTGTCCAAACACACTCAGCACATGGGTGCACACCCTCGAATCCAATTACCTATACCACAAACCATCTGTCCAACTA
          CCGGGTTTACTACTCCCTTTCCCTGGGATGCACTTCAACCCGGCGCACAACGTTTTCCAATTAGCCAAATGGATATATCA
          GAGGCCGCCACGCCACTTGACACCTAAGCGGTTCCGATCGGATCCTCTGGACCGCAAAGTGATAAAAAATCTCGGGTTCT
          AATTTCATTGTAATTTCAGCGTAAGAAAGGCAAGGCTAATTGTTTGCTTAGCACAGGTCAACTGCAATGCTCATGGTTTA
          GGTTTAATGGCCCATGTTTAACTGGGCGTATACGTAATGTGCAGCGTTGCAGGGTGAACTTCTCCAGCTCGCTAAGTAAG
          TGTTTACGACGCGATGCCATTGGACATGTGGATGGATGTGTGAGTGAGAGTTTGGCCAGACAATTGATATTTTGCGATCG
          ACGATTCTGGGTATAAATAACTGGTGAAAAAACACCGAACACCTCTCATTCAAGCATCAGTCGCGTCTGCGCCGTTCTAC
          GTCGGACATCGGATTACGGATAGCTGAATACGGAATACGGATTTCCGGCCTGTCTTCGCGAAAAGGATCGTAATAAGAGC
          CCATCGGAAATGGCAACGGATGTGCAATCTTTTTACAAAGACAAAACTGTCTTCCTAACAGGCGGCAGTGGATTCCTTGG
          AAAAGGTATTCCGTCTTCTAGTTGACAGTTGACTCAATAGATCTGCTAAAGTGTGGTGTAAATGCATTAAACGCACATAA
          ATTTAAAGGCCAAATTCCTGTGATTTGGACTTTTGCAAGCTATTTGATATATAGATGACATGCATCTGCCCAGATGGTTA
          AAAGTTTGATGCCCAAAACAAGCGATACGCAGAACCGGCTGTAACAGTTCCAAATATCAGATCAAATTCAAGATCAAGAA
          CAAGTTTATTGCCGTTTCAGTGACCATTGCGAAGCTGCTCTGCACCACCGAGGTGAAGCGCATCTATGTGCTGCTCCGTG
          CCAAACGCGGCCAGGAAATGCGGGAGCGATGCGCCGCATGGGATAAGGATCCGGTATTCGGTAATCTAATGAAAACAAAT
          CCCGAGGCTCTGAAGCGCGTGGTACCTTGTGGTGGCGATTGCCAGGAGCCGGATCTTGGCCTGAGCAACAGCGATCGTCA
          GGTTTTGATAGATGAGGTGCAGATTGTTATCCACACGGCGGCCACTGTGCGTTTTGTGGAGCCGCTGCACATCGCCCTGG
          CTGTTAACACCCGAGCCACCCGACTCATGATTCAACTGGCCAAGGAGATGTCCCACTTGGAGTCCTTTGTCCATGTGTCC
          ACCGCGTACTCAAACTGCGTGGTGGAGCACGTAAGTGAACGCTTCTATCCGGAGCACTTGACCTGCCCTGCCGAAAAGAT
          CCTAGAGCTGCTGGAAAGCATAAGTCCTGAGCTATTGGATAAAATGGCACCGGCGCTGATGGGCAAGTATCCCAATACGT
          ATACGTATACCAAGGCTCTGACGGAGCAGGTGATCCAGAAGGAGGCGAAAGATTTGCCGCTTAGCATTTTTCGTCCGGGT
          GTCATAATTGCCAGCTATAAGGAGCCCATGCCCGGCTGGATCGACAACCTGTACGGACCCATTGCAGTTCTCTACGGAGC
          AGCCTTCGGAATACTGCATATCACACTGCTTAATCTTAAGGCCCAGGCTGGAATTGTACCCGTGGATTACTGCGTCAATA
          TGGTGCTGACCTGCGCTTGGAACACGGCCCGGGATACAAGTATCAAGCTATCGCCGGAGCCACCTATCTACAATTTTACG
          CCAAATAATGATAACCTGATAACCTGGGGTGGATTTCGGGACAAGGCGGCGAGGCTGCGGTACACGTATCCACTGACCAA
          GATGATGTGGTTGCCGTTTCTGCATTGCACCACCATTCCCTGGCTATTCCGGTTCACGGCCATCTTTTATCACCTGCTCC
          CCGGCTATGCCATTGATCTGGCCTTGCGTTTATGGGGCAAAAAGCCACGTATGATCAAGTTGTACGACAAGATCCACAAG
          AACATTGATATTCTGGCACCCTTTGTGATCACATCCTGGTCGTTCGATACCGTCAACACCCGCAAGTTGTGGGCCAAAAT
          GTCTGTCGAGGATCAAAAGCTTTACGATTTTAATATGAGCAGCGTCGACTGGGATGATTACTTCCTACAGGCACTGGCCG
          GAGTTCGCATCTATCTCGCCAAGGAGGAACCAGGACAGGAGGTAGTGGAAAGGGGACGAAAGATCTATAAAAGGTTTGAA
          TTTCTTCATCGGCTGCTGCAGTTCACTCTTTGTGGCGGTGCTGCCCTAATATTGTGGTCAATTTTGAAGCGACTACTGGG
          CTCATTTGTATAATAATCACAAATAAAGTTAATTGGCTATGATTTACTCACTCTTTATATCTCATTTTTAACATCAAAAA
          CAGCAATTATATAGGCGTTATCATAGCTATAGCTATTTTTATAAAGCAAAAACCATCATTACGTTTTTTGAACGTTCTTT
          TAGAAGGATAATTTTCATATAACACGCAAATTAAGACAAAAAGCAACTTGTATGCAATTAATAAATGTTTTGGCCG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0082604
          1841
          FBtr0347002
          5233
          FBtr0347003
          2358
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0082073
          451
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0082074
          502
          FBpp0312434
          451
          FBpp0312435
          502
          Comments

          Dicistronic transcript.

          Transcript terminates at site supported by polyadenylated cDNA.

          transcript_exception: dicistronic_mRNA

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (3)
          Reported As
          Symbol Synonym
          CG10096-RA
          CG10096-RB
          CG32919-RB
          Secondary FlyBase IDs
            References (2)