Open Close
General Information
Symbol
Dmel\Lkb1-RD
Species
D. melanogaster
Annotation Symbol
CG9374-RD
FlyBase ID
FBtr0082811
Feature type
Associated gene
Evidence Rank
Length (nt)
2422
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 111 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Sequence
        AACTTACTTTGGCCAAAAACTAATTGTTAAACAATTTTTCGGAAGGGGAAAAGAACAAATTGAACGGCGAGAGTAAACAC
        AGGAATTCACAAATTTCTATGAGAAACAGATCGCACGACGGTGAAACGAAAGGGGGGAACGCCTTTCCAGCGGACATCGC
        AGAATAGACGACGGGCGACGAGGGACCTCGAAAAATCGCACGGCAATCAATTCGAGTGTGTGCGAATTGATTACAAAAAT
        AAAGGTATTTCGAGAGGCAACACAGGGACCACACCGTCCACTCCCATCCGCCGGAGTGGGGCTGCCACCTGCGATATGTG
        ATCATTGGGGCTCCGCGGAGGTTTATGCAATGTTCTAGCTCTCGGCCAGTCGGAGGTAAAGCAGCCGGTGGAGCAGAAGC
        AGGAGGGGCAGGAGCAACAGGCCAGATGACTGTGACCACCATGGAGGCACAGGTCAAGGCAGCACACCATCATCATCTAC
        ATCATCCCACGGGCGGAGGGGCCCAGCACAAGGTGGAGGAGGAGGAGCCGGATCCTGTTGAGGACGAGATGACCGTACTG
        CTGGCCAATAAGAACTTTCACTATGACGTCGCCTCCGATCTGGACGACGACGCTTTTGTGGAGCTCAAAGAAGACACCGC
        CCAAGCGGATGATGCGGGCGCGGGCGTTGGCTTCTACAATCCGGATGAACTGCTGCTCGATGACCAGCCACATCCGCAAG
        TCACGTGGCTGGACGACGACGAGATCGAGACGCTCGATCGCGTGACGCTGGACATGGGTAATATGTTCTTCAATCGCGTC
        GACAGCCAGGACATCATCTATCAGCAGAAAAAGAAGAGCATTAAGATGGTGGGCAAGTACATAATGGGCGATGTTCTCGG
        CGAGGGATCGTACGGCAAGGTGAAGGAGGCCATGAACTCGGAGAACCTGTGCCGCCTGGCCGTCAAGATCCTGACTAAGC
        GGAAGTTGCGCCGGATTCCCAACGGCGAACAGAACGTAACGCGCGAGATCGCCTTGCTGAAGCAGCTGAAGCATCGACAT
        GTCGTGGAGCTGGTCGATGTTTTGTACAACGAGGAGAAGCAGAAAATGTACTTGGTCATGGAGTACTGTGTCGGCGGGCT
        GCAGGAGATGATTGACTATCAGCCAGACAAGCGGATGCCGCTGTTTCAGGCGCACGGTTACTTCAAACAGCTAGTCGACG
        GCCTGGAGTACTTGCACAGCTGCCGGGTCATCCACAAGGATATCAAGCCAGGCAACCTGCTGCTCTCCCTGGATCAAACG
        CTGAAGATATCCGACTTCGGTGTGGCGGAGCAACTGGATCTGTTCGCACCTGACGACACATGCACGACGGGCCAAGGTTC
        TCCGGCCTTCCAGCCACCGGAGATTGCCAACGGACACGAGACGTTCGCCGGCTTCAAGGTGGACATCTGGTCCAGCGGAG
        TGACTCTCTACAATTTGGCCACTGGACAGTATCCCTTCGAGGGCGACAATATCTACCGACTGCTGGAGAACATCGGGCGA
        GGTCAGTGGGAGGCGCCCGCGTGGCTATACGAAATGGACGCGGACTTTGCCAACCTGATTCTCGGCATGCTTCAGGCTGA
        TCCCAGTAAACGCCTCTCTCTGCAGGAAATACGCCACGACACTTGGTTCCGATCCGCACCGGTTAAGACCGGCCCACCGA
        TACCCATTCCCCCCCTGAAGGGTGACAAATACCGCAACTCCACGGTGATACCTTACTTGGAAGCTTACCACTACGGCACC
        CAGGAGGAGGATGTCTACTTTACAGAACACGACGTAAATCAGGAGCTCGCCCGCCAAGCGGCAGCTGCTGCCTCCGAAAT
        TCGGGCCAAACAGTCGGCGGCAGCCCTAGCCGCCTGCCACACCTACGAACCGCCCTCCACAAGTGCCGCAGCCGCCAGCA
        ATTCGCTGGGCAACGGTAGCAGAGAGGAGGCGCCCGTCAAGAAGAAGGGATCGGCACTGAAGAGGCGCGCCAAGAAGCTG
        ACGTCCTGCATCTCCGTGCGCAAGCTGAGCCACTGCCGAACTTCGTAGGCGCCTTAGATGCCTCCACTAAACATAGATGC
        TAAGATTTATCGAAAGGAATAACTTTGTTAACAAATTTATTTGTAACCATAGAATCATGTAGGAAATTCAGGCGCAACCT
        CGTACCGCCCGAGCAGCAGGAGCAGCAGCGGTCGCATCAACAGCAGCAACAGCCCGCATCAGCGGAGTTGGCTGTGGAAT
        TGGGGAGCTATGGGAGCGACACGAAAGCTATATATCCATGTGACAATACTGTGTATTATATGAAACAAATGAATGCGTAA
        ATTAGTCGTTAATATATTATGATGTACTGAAGGCAGCCGAGGATTGCCGGAGGAGACGGTGCCCATTGGTGCGTCGCACA
        CATAAAGAAATATGTTCAAGTG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0082808
        2428
        FBtr0082809
        2397
        FBtr0082810
        2391
        FBtr0082812
        2553
        FBtr0082813
        2407
        FBtr0082814
        2401
        FBtr0082815
        2403
        FBtr0301488
        2487
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0082279
        567
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0082276
        567
        FBpp0082277
        567
        FBpp0082278
        567
        FBpp0082280
        567
        FBpp0082281
        567
        FBpp0082282
        567
        FBpp0082283
        567
        FBpp0290703
        567
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (3)
        Reported As
        Symbol Synonym
        CG9374-RD
        Lkb1-RD
        Secondary FlyBase IDs
          References (2)