Open Close
General Information
Symbol
Dmel\CG6218-RA
Species
D. melanogaster
Annotation Symbol
CG6218-RA
FlyBase ID
FBtr0083119
Feature type
Associated gene
Evidence Rank
Length (nt)
2091
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 30 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GAAATCAAATCTGAAAATAGGGATGAGTACATTTGATTAATTTCCAAAAATTGTTGCAATCAGTTCAAATCAATTGCAAT
        ACACAATGCACACAAGTAACTTATAGGGGCGGAAGTGTTTTCTGCAGCTGGCGACAAACACAGTTGCGTGTACAATATAC
        CCGTGTATTGGGCAATTACCGGGTATAAAAATATCAAAGAGTCGCTGAGCCCCGAAGTGAGTATATGGCCAAACACAACG
        CATTTGTTGTTCAAAGCGTTCGGAACGTGGACGGATTGAGCTCCGCCGGGAACCGCCTTCTCCACATCAACAGCCTTTTG
        AACCACATTCCTGTTGGGATTCGCTTTGGCCCAGCTTGCTAACTCACAATGAAATATTTTGGCGGAGTCGAAGGCGGAGC
        CACCCACTCCAGACTGGTCATCTGCGATGAGAGCGGCCAATCTGTGGGCGCCACCAGCGGCCTGGGCACCAATCACTGGG
        GCATTGGCATTCCGGAGTGCGCCCGCCGGATCGCTGACATGGTGGAGCGGGCGAAGGAGGAGGCGGGCATTCCCAAGGAG
        ACGCCCCTCACAAGTCTGGGATTGAGCCTTAGCGGCTGCGAGCAGGAGGCCACCAATCGCGAGCTGGAGCAGGAGCTGCG
        CACCACGTTTCCGGGCCTGGCCCAGAACTATGCCGTGTCCAGCGACACCATGGGCAGCATGTACACCGCCTCGTCCATCG
        GAGGAATGGTCCTTATTTCAGGAACCGGATCCAATTGCCTGCTGCGTAACCCTGACGGCTCCACGTCCAATTGTGGCGGC
        TGGGGCAACTTCCTCGGGGACGAGGGAAGCGCCTGGTACATCTCGTATCGCGCAGTCAAGGTGGTGTTCGACCATATGGA
        CAACTTTGAGCAGTCAGCGGCTCCCGTGGAGAAAACTTGGAGTCTGATCAAGGAGCACTTTAGTTTGGAGACGCGCCTGG
        ATATGCTGCCGCACTGTTACGCCAAGTTCGACAAGCCCTTCTTCGCCAATCTGTGCAAAAAGCTGTCGCAGAACGCCGAA
        AATGGAGACGAACTGGCGCGCAGCTTGTTTCGCGAAGCTGGCGTTCATCTGGCCAGAATGATCCTTGCCCTGCTGCCCAA
        TGTGCACCAGGATCTGGTCAAGTCCGGGGACCTAAGCGTAGTGTGCGTAGGATCCGTGTGGTCCAGCTGGGATCTGCTGC
        AGGAGGCCTTCATCAGTGAACTCGCTAAGACAACCATCGACTTCGACCTCAAGCTGGTGCGCATCACCAAGAGCAGTGCC
        TACGGAGCCTGCTACCTGGGTGCGGATAGTGCGGACTTCGATCTTCCGAGAAACTATGCCGACAACGTCACAGTACTGTA
        CACGTACACCGATCCTCGAAAGAAAGCCAAAGCCACCAACGGCTGTAACTGTTAGATAAATTGTGTTTGACAACCCATTC
        CGCAATACACTTCCCAATTGCCAAATTCGCAATCAATATTCCAGTTAGTGGTACGGATAGGTAGTATTATAGCTTATCAA
        AAAATAAATAATTTTATCCTTTGACGAAATCCGCTGGAAAGTAAAGAAGTTTCCCTTTCAATCTTGCATCAAACTCACCT
        ACATATACTTTCTAAACTTTTTTTGTTGGGTTTGTTAGAAATACGTATGAAAATTTTATTCGATAATGTTCATTGTATTA
        ATTGTATGTGTCTCAATTGTTGGCTGTCGTGGCTTCTTTTCATGTATGTGGGCATACATGTGCGGCATCTTCTTTGTAAT
        ACTTTGATTGTGTTTAAAGCCAATTTGTTTTTATTTTCGCAGTGCTGTCAATTCAATTCTTTGGCTAATTTGATTCTCGA
        ATCGGGAAGCAGAACATAAATGTATCTGTTTGTAGCGAAGGAATACATAGGCCAAAAACATAATATCTTAGGGAGCTTAG
        AATAGAGTATTTGGGATAATGTACGAGTAGCTGAATCGAATGCCGTAGCAAGTGAATCAAAATTACATCTACATGTATAT
        ATATATAATTGCTTGGATAAAACATTTAACGTACTGTAAGATTGAATGCGACATACCAAAAGAGATTTTCAATAAAATCG
        AATTCAAATAG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0334590
        1400
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0082573
        348
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0306657
        348
        Comments

        Extended 5' UTR based on RNA-Seq and/or EST data.

        Extended 3' UTR based on RNA-Seq and/or EST data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG6218-RA
        Secondary FlyBase IDs
          References (2)