Open Close
General Information
Symbol
Dmel\Akt1-RC
Species
D. melanogaster
Annotation Symbol
CG4006-RC
FlyBase ID
FBtr0083228
Feature type
Associated gene
Evidence Rank
Length (nt)
3649
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 140 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Sequence
        CCAGTTATCGAAAAAAAGTGAAGCGTAAAAACTAAACGGTACTTGGAAAATTTACTTTGCCTGTGTGCGTGCTTCTGTTT
        ATGAAAACTACGTTTTTAAGCATTTGCAATTGATGCAACGTTGCTTTGGAAGGCAAGAAAACACCAAGTGGAAACGCCCG
        GGTGGCGGAAATCGACTTCCAGTGCGCGAGTGCGAGATTGTGTGTGTTTCGTTCCGTCCTCTGGTGTCTGGCACCTTAAC
        ACAACAACAACTACAGCAGCAGCAGCAACAACAACAATAGCAAGCAGCAACAACAACACACGCACAATAATAAGAAGGCC
        TGTGACGTTGTCGCTGCCGTCACCATCTAAAGGAAAATACCAAAACGAGTCCCTCATTAGCTTGTCCCTAGGGTTAGTGA
        AACAGCCTCAACACGAATTACCTACCGTTTGTTCTTCAGCGGCGATCGACTGTGGTTGCCAGCGCCCCAGCGCCAGGATC
        TGCCTCTAGGATCCCGGAATCGCCCACCACCACAGGGAGCAACATCATTAACATCATCTACAGCCAATCCACCCATCCAA
        ACAGCAGCCCCACCAGCGGCAGTGCAGAGAAATTCAGCTGGCAGCAATCCTGGCCAAGCAGGACCTCCGCGGCCCCTACA
        CACGATTCCGGAACCATGTCAATAAACACAACTTTCGACCTCAGCTCGCCCAGCGTTACATCGGGTCATGCGCTTACGGA
        ACAGACTCAGGTCGTAAAGGAGGGGTGGCTGATGAAGAGGGGCGAGCACATAAAGAACTGGCGCCAGCGCTACTTCGTGC
        TCCACTCCGATGGAAGACTGATGGGTTACCGCAGCAAGCCGGCAGATAGTGCCAGCACGCCATCGGACTTCCTGCTCAAC
        AACTTTACGGTGCGCGGCTGCCAGATCATGACCGTCGATCGGCCCAAGCCATTCACCTTCATCATCCGCGGCCTGCAATG
        GACCACGGTAATCGAAAGGACATTTGCCGTCGAATCAGAATTAGAGCGCCAGCAGTGGACGGAGGCCATTCGCAACGTAT
        CCAGCCGGCTCATAGATGTGGGTGAGGTGGCTATGACGCCATCTGAACAGACAGACATGACAGACGTGGACATGGCCACC
        ATTGCCGAGGACGAGCTTTCCGAGCAGTTCTCCGTACAGGGAACGACTTGTAATAGCAGCGGCGTTAAGAAAGTGACTTT
        GGAGAATTTTGAGTTCCTCAAGGTGCTCGGCAAGGGCACCTTTGGTAAGGTTATTTTGTGTCGCGAGAAGGCTACCGCCA
        AGCTGTACGCGATCAAAATTCTTAAAAAGGAAGTTATTATCCAAAAGGACGAGGTGGCCCATACCCTGACCGAGAGTCGT
        GTGCTCAAGTCCACAAATCATCCGTTCCTCATTTCACTCAAATATTCGTTTCAAACCAACGACCGCCTGTGTTTTGTGAT
        GCAGTACGTGAACGGTGGCGAGCTCTTTTGGCATTTAAGCCACGAACGCATATTTACTGAGGATCGAACACGTTTCTATG
        GGGCAGAGATCATTTCTGCTCTGGGCTATCTGCATTCACAGGGCATAATTTATCGCGACTTAAAGCTGGAAAATCTTTTG
        CTGGACAAAGATGGTCACATAAAGGTCGCAGACTTCGGTCTGTGCAAGGAGGACATCACCTACGGCCGCACAACGAAAAC
        CTTCTGCGGTACACCGGAATACCTAGCTCCGGAAGTATTAGATGACAATGATTATGGCCAAGCGGTGGACTGGTGGGGCA
        CTGGCGTGGTCATGTACGAGATGATCTGTGGTCGTCTTCCGTTTTACAATCGTGATCATGATGTGCTCTTTACATTGATT
        TTGGTGGAGGAGGTAAAATTCCCGCGTAATATCACAGATGAGGCGAAAAATCTGTTAGCAGGCCTTCTAGCTAAGGATCC
        CAAAAAGCGTTTGGGAGGTGGAAAGGATGATGTCAAGGAGATACAAGCACATCCATTCTTTGCGAGTATTAACTGGACAG
        ATCTAGTGTTGAAAAAAATACCGCCGCCTTTCAAGCCTCAGGTGACATCCGATACGGATACAAGGTACTTCGACAAGGAG
        TTTACGGGAGAGAGTGTGGAGTTGACGCCGCCGGATCCCACTGGCCCGTTGGGCTCCATAGCCGAAGAGCCGCTTTTCCC
        GCAGTTCAGCTACCAAGGAGACATGGCCTCCACGTTGGGCACCTCGTCGCACATTAGTACTTCCACAAGTCTCGCATCGA
        TGCAATAGAACAAGTTTACAAACTTTTACCAGCACACATCATGTTCTGCTTCATCACCTATTACTATACTATACCTATAA
        CACATAGAAATGGGCAAAAGAAAACAACAGCAAGAATATATTAAATATTAATTATACCATGATAACGAAGGCAAGCAAAG
        GGTTTTCTTGCTAGTTTATATACACCAATAATAAGAGAATTGAATTGATAGTAACTTATTTTTGTATAATGAGAAAGGGA
        ACGTTGAACGAAAGGGCAACAGCCGAAGCCGAGGAAAATAATTTACTACATATGATTATACACATATATATAAATATATA
        TATATATATATATATAATTATATATACAACTAAATATAACACTTGGGGCATAGCGCTTGAAGTGATTAGTTAATTTTAAA
        CGCAAGGAAAACATTTAACCAAGCGACTTAGAGCGACTTAGTGCTAGGATAAAGCATGCATCATCGGATCGCATCCTCTA
        GGGGTCGCTTAAGCTGATTGATTATACAGATTATTCACGCAGACAGCACTCACACAGCCACTTAGCATATAGCGAACATG
        AAGTTTAGTTAACTTGACAGCAACAAATCGAAATACACATATTCAACAACCGCCCCCACATGCAACACTCGTATATATAA
        ATTATTTATACTCCAAAGAAGCAAAAAAGAAACAGAAACAATTACAAGTTATATATAATGTTAAAATTGCCTCTAATGTG
        CTGTGCTTTATGCAAAACTACAACAACAGAAACAAACAAACTAATAGTTAATAAACGAGGGAAACATACATCAATGCAGT
        TTATAGGCGCCAATAATTAGCAAGCAACTAAAAGTTATATTCAGGCAGAAACATATTTCGAAACAATAACGGCAACAGCA
        AAATGATTACAATTGACGCCATTTTTTATTATAATTTTTTACGAAAAATATATATTTGTAAATATTTATAAAAAAAAAGC
        AAAAACTCAAGAGTAAATGCAAAAAAAAAACAAAGGATGTATGTGTCGTGTGGAAAATGGAAGTCACCATTTGAGGCCAC
        AGAAAAGGTTTAACCTTTGACACAATAAAAAATGTATCTTTGTCATTTCATTTTTGGCATTGAAAAGTTCATAACAAGTT
        TTGTATACTTAGAGCAAGTCAGCAAAAAATATATATAAATCAACCACAACAGACTTACAAATAGTTCCAAAAGGAAGATT
        AAAAATTATATAAACAGAAAAAAAACCTAAAAGAAAATAAAGAATTTTTGATATTTTTATATGCGCAATAAAAACAAAAA
        TCAAGAATAAAACGAAACAAAAAGTTATTTTATATTTCGTAAAGAAAACAAAATAAATATTGTAAATAAAAATTATTAAA
        TAAAATCAAGTTCGGGAATTTCAACTGAAAACAAAGAAATTGAAAGCAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0083227
        3714
        FBtr0083226
        3649
        FBtr0344470
        3301
        FBtr0344717
        4869
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0082682
        611
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0082681
        530
        FBpp0082680
        530
        FBpp0310841
        530
        FBpp0311050
        530
        Comments

        Unconventional translation start postulated (ACG encoding Met); accession CAA58499, X83510

        Transcript terminates at site supported by polyadenylated cDNA.

        translation_exception: non_canonical_start_codon

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG4006-RC
        Secondary FlyBase IDs
          References (2)