Open Close
General Information
Symbol
Dmel\CG14880-RB
Species
D. melanogaster
Annotation Symbol
CG14880-RB
FlyBase ID
FBtr0083321
Feature type
Associated gene
Evidence Rank
Length (nt)
2599
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 30 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTCAGTTTAAGACGCGACTTCGAACGAAGCGGTTGTGTTTTATCGGGCGAATTGCGAACCGTCAGATACAAGATACAAAC
        TTGGATAAGTTTTATAGACGCGCTCCATTCGAAAAGGACTGTGAAATGATGTGCTAAAGTGTTGATGGCATGTCTATATA
        GTATCAAAGCAAATAATTTATGCGAACCAATTCGGTTGCTGGCGTTGCGCGATTGCTCTTGACTTTGTTTTCAAGCCAAT
        GCAATTGCATTAGCTATCTGAGCTTGATGCACTCCGAGTGCTGCTGACATTTGATCTTTGCAAAGATCACATCGCACTGA
        ATCACCAACTCGCATCGGATGTGTGAAAAGGTCCGCGACCATATGGAATATATTTTAGCACACCACCTACGGCGACAATT
        AGTTTGTACAATTTAAGATACTCCGTCAACTGAAGACGCGGGCGAAGTTTTTTAGCTCAACATCGTGAGTTCCCTCCCCT
        CCCAACAATCCCCAGTGCCACAGAGAACAATCGTCGAAATGTTGGCACAAACGCAAATTATCCCAACGCCTTGGCGACTT
        TTGACCCTGGCTTTATTCTGCTCAGCTTTATTTTTGGCCAGTGAGGCTCAAAATGCCATCCCAAAAACGAATCCTGCCTC
        GCTGCTGATACAGAAGACATCCTTCTCCTGCGCCGGACGTCCAGCCGGATATTATGCGGATGTGGAGACGGGCTGCCAGG
        TGTACCACATGTGCGATGGCCTGGGTCGCCAGTTCAGCTACACCTGCCCAAACACGACACTTTTCCAGCAGCGAATGCTT
        ATCTGCGACCACTGGTACATGGTGAACTGCTCCAAGGCGGAGAGCAACTATGCTGCCAATCTCCTAATTGGTCAGCGGGA
        CAAGCCCTTCGTAAACGACGAGGAAAACAGCTTGCGCACTCCAAGACCCGATCTTCTGGATCGTCCTTATGCGCCCGACT
        ATTCCGGCGAGTCCTTCAGAAGCCAATATAAGCAGTTTACTTCCAACCAGAATCAGATACGTGATGAGTCCGTCAAAGGA
        GCCGGTGCGGGTAAATCGGATCCCCAGATATCGCAGACGCGTTGGCGCATTCCACCACCCAGCCGGACGATCCTTCCACC
        GGCCTATGAACCGCAAATCGAGCTGCCCAGTGCCCAATCGGCCAAGCCCAGGATACCCATTATCACTAGCACCACCACAA
        CCACTCGAGCGACCACCACCACCCGACCAACAACCACAACTCGTGCCACCACCACAACAACAACCACTCGAAGACCTCCG
        GTAACCGCCAGGCCGAAGGAGGCCTTGCACAACAGGCGGCCAAATTTCCAGGAGCATGATATGGATGACTTGGGCACCAG
        CCACAGCACACGGTACAACACCTCGGCAGACTTCAACTCGGCGGAGTCGCCGCTCCGTGAAACGAAACAGTCCAGCACCA
        AGCTGACCAAGTTCATCAAGCCGCCGTCCAAGATCTATGAGCCACCCTTTGTGTACCCCATCTACAATCTAGAAGAGTCC
        CAGACCCAGAACGCGGCAGTCGCCACCACACTGCGCACATCAACGGCGGCTCCTTTCAGTCCTGTTCCAAGTCGCAAGGA
        GGTCAGCACCACAACTCCACGACCACTGAGTCGACCGACGACCTTGGCCGGTGTACCCTTCTCCTCTGCCACACACCCAA
        CTACGGTTACGACGGTCGGAGTACCGCCACGCAGCGATAATCGGACTCCAGCTCCGGCCCAGAGCTTCCGCCTGGCCACG
        CCCACCAGCACTGCAGCACCACCATCGCGCCCGGCACAGTTGCCCTTCAACGATTTACTGCCGCCGTTCGTTGACTTTGT
        GCCCCACGATATAGCCACCACCCAAGGACCGCCTATCTATTACGAATGGAAGGTGCCCTCGAACGGTCTTGAGCCTCCCA
        AATTAGACCCACCCATTGGTGTGGATGGACGTGAGTATCCCGAGACCACTGGAGACTACGGGGTCACCAGCAAGCAGGAT
        GTATTCAACACCCGACTAAACGATATTGGAAGCCATCAAAAGAAGCCAGTCCAGATAACCTCGCCGCTCCAACAGTCGAG
        CACAAGCCATCGTTTGGCCATCTCGAGATCCATTAAGCCCAAAGAGGAGCAGGAATCGGCACAGCGGCGATCCGATGTGG
        TGGCCAGCTCCACGGATATAAGCCATCTGCGCAAGCAATTCCTCATTCCGGAGTACGCCTTCCCGCTGGAAACCATTGGG
        CGCACGGGTTATGGTCCTGGTGCAGGAGCAGCGGCTGGGGGCTCCGGCTCCAGCAACGGCGATCTGTATAACTCGTTCCA
        GCTGAAGATCCCCGAGCAGCGCGCTAAGTGGTTCGGAGAGAACCCCAAGTGCCCGGAGTGCCATCCTTCGTTCGTTCTGC
        CGGGCACCTGCGAGCCCTGCCTGCGCAGATAGTCCTGATTCCATATCCATTCCCGTCTCCGTCCGTCCCATCGCCCATTA
        TCCGCATCCGCATCTGCTACTAGCCCTAGTATTAGCTTCCGCTGAGAAGTCCCGGAGTGAAGCATCCACGCATTTATTGT
        ATATCCGCAGATTAATTATTAAACTACACAAATATGTTT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0083320
        2591
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0082771
        637
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0082770
        637
        Comments
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG14880-RB
        Secondary FlyBase IDs
          References (2)