Open Close
General Information
Symbol
Dmel\CG5316-RA
Species
D. melanogaster
Annotation Symbol
CG5316-RA
FlyBase ID
FBtr0083759
Feature type
Associated gene
Evidence Rank
Length (nt)
2610
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 88 )
Sequence
GGCACTGGGATGTCAACTGCCAGTAAGAAAAGAAAGCAGTTCTTAGCAAGTTAACAAATAAATAAATGACAAAATAATAA
CGAAATATATAATAACAAAATAAATAACGAAAATATTTGCTTTTGTGCAAATACGCTCACAGAAATCGATAAAAGTCTCG
CCGTTGCTGCAATTCCAAGCAAATCAGGCAGTAGCATTTGTGATGTCCTGGTCAAGTGCACTAATCAAAGATATCTCGAA
ACCAGAAAATTTGATCATTTCGTCAGAAATCGCAGTGGTCATAGCAGACAAGTTTCCCAAGGCGCAGCATCACTACTTGG
TGCTACCATTGGCCGACATTCCCAGCATCTTTCACTTGAACCGGAGCCATCTGTCGCTTTTGGAGGAGCTGCATCTGCTG
GCCAGGAACGTTGTGGAAGTGAAAGGAGTCCGGTGGCAGGACTTCAACGTGGGATTTCACGCGGAGCCGAGCATGCAAAG
GCTCCACCTGCACGTCATCTCCAAGGACTTCGTATCAACAAGCCTGAAGACCAAGAAGCATTGGAACTCATTCAACACCG
AGCTGTTTGTGCCCTACACAAGTAAGGCTATTAGAACACGGCGCAGGCTACAGGCTTCATGAGCGAAAAACAGATAAATC
GAATGATCTAGTTAGAAAATAGAGATTTGCCGGCGGTGCCAATTTTTATGAGCATTCCCATATAGAAAAGCTTTACGCCC
AGCTGGAGAAGGAGAATAGCATTTCGCGACTCCCGAAATCACTAAAAGACGAGCTGCTGGCCAAGCCACTCATTTGTAAT
CAGTGCGAGTTTGTTGCAAGAAATTTGCCATCACTTAAGGGGCATCTGGTGGGGCACCTTCAAGATCCGAAATCAGTTTG
CCAGCGAGTCCGACTAGGGAACCAGTTCTTTCCCACAGCTGGTTACAGAACGTCAGAACTTGCATATTGTTTCGATTTCG
TGGATTTCTACGAATACAAAAAGCAAATGGAGGTGGATAAATTGGCATATATCCGAGATGAGCTGCAGCGCAAGCTAAAT
GATAAGAGGAACTTCCTTATCGAGAGTGACCGGGCGGTGGTCATGAAAGCGGACTATCCTAAATCGCAATACCACTTTAG
GGTGGTGGCCAAGGAAGAGTTCAGGGATATAACTCAGCTAACCGAAGCGCAGCTGCCCCTGCTGGATCACATGATGGATC
TGGCGAATCAAATCATCGAGAAGCAGAAACACCTGGAGTCGCGTAATTTTCTCATCGGTTTCAAAGTCAATACTTTCTGG
AATCGTCTAAATCTACATGTTATTTCTAACGACTTCTATTCCATGGCCATGAAACGTATAAGTCACTGGAATAGTTTCAA
TACGGAACTATTTATGCCCTTTCAAATTGCGTATATGATGCTCAGTGTTCAGGGATCCATTGAATCCATTTCGGAGGAGA
CGTACAATAATTTGCAAGAGAAGACGCCATTGCGATGCAACCAGTGCGAATTTGTTACTAATATGTTGCTGGATCTAAAA
GCTCACCTGTATCAGCACTGGCAGCGCAAGGAGGACGAGCGCGATCAGAAGAAAAAAGTCGATAAAATAATCCAAATGAT
ATCTGAGACCAAACTGGATGAGGCAGAGGCAAAGCCGAAGCTGTTGAATGAAGAGGAACCTATTCAAGCTCAGCCCGTTG
CCGCTATCGCCCAGTATCCCAATGAACATCTAGGCAAGCCCTTAACGCCGCAACAGCAGCCGGGCAAGCAGCAGGCCCAG
AATGTTTACGACAAAAACATTAACGGGCCTTCTGTGAATATGATGAATCAGAACAATCCCAACAATCCGTTCCGGAACAC
TCCGCACCTTAATAGACAATCACAGAAACCGCCGCATCCCCGCTCTGGGCCCCGTGGACCAATGGCTCCTTGGACTGGTC
CGCGCTTTCCGTGTCATCAACAGCAGAACAGATTCAGGCCTCCAGGATTTAACGCATGTCGGCAACCTTATCCACCCTAT
CATTCAGGCCATCAGCAATTTCCGAATGCTTCATCAGTCGGCGGCGGTCAAACTGGGCTGCCAGGTCAGGGACAGGGACC
TAGACCGAAATGGAATTCAAATAAGATATTCAATCAACAGAACCGCCAAAATACAGTCCAAGCCCAGCCACAAGCCCAGA
ACCAACAAACCAACCAGCAGCAGATTCAAAATTCGAATAAAAACCAAACTCCAAAAAAAAAGCCATGGAAAAATCGCCTG
CAACCTGTAGGCAAAGTTCAGAATCAAGGCGGAGCGAATCGCGATCCCGCACCTCCAAGTAACTCGAAACCATCTTAGGA
TGATTTATCCTATTGAAACAATTCCTAATTCCAAATTCCCAACAGCAGTTGGTAAACTACCAGAAAGACTTTAGATCCAC
ACAAATCGTTCCCAAATTGGCATTTTGCAATAAACAAGATGAAGGCAGGAAGAAAAATTAAGAAATCACTTGGGATTCTA
CAAAATCAAACGATTTCAAAACAGCGCAACTCCTAGAATATTTTTCCCATATGAATTTTTTTTCTGTATGTCATATTTTA
AAAATAAAGTTCTTGTGAGCTCTTGGGAGTTCGCGAAAATTTTGTAAAGC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0083760
2483
FBtr0083758
2376
FBtr0445726
2553
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0083173
139
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0083174
662
FBpp0083172
662
FBpp0401601
443
Comments

Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG5316-RA
Secondary FlyBase IDs
    References (2)