Open Close
General Information
Symbol
Dmel\Syp-RF
Species
D. melanogaster
Annotation Symbol
CG17838-RF
FlyBase ID
FBtr0083961
Feature type
Associated gene
Evidence Rank
Length (nt)
6794
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 19 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          ACGAAGTGAAGACCAGAATTGCGAGCGGAGCGGCCACAGCCTCTGCTTCTGATTCTGCTGCTGCTGCTGCCGATTCTGAG
          TTCTCGATTCTCAGTTCGATTCTCAGACGTTGGCGAACCGAGAACCGGTGACGTAGACGTTGCCGTCCGCCATTATTACA
          ACGCGGCTGCCACACGCAAAATTGGACATACCAGCTAACCAAAAATAACCAACGCCAACTGCAGCTCGGATGCGAAGTGT
          GCTTGCCAAAAGTCAAACGATAACGAAAATAACGCAGGACCATAAAATTCCCATAGTTATATTAACAAATAAAGCAAAAT
          ATGAAATATGCTGGCTGAGAGCGCGCGCGGCATGCGAATCGAAACGGAAACGTAACGACGGAACGGCGGGCGGCCAATTG
          TGATCTCATATACGCTACGATCTTAAATAAAATACAAATATTCTATTTAGAAAATGCCTGGAATCTAGCAACAAATTGTG
          CAACGCCGAGCAGAGTATAACAACTAAACAAAATAAATACCGATAGTTCAAATTGAACGCAACGAAGTAATATTGTGAAT
          TTCTTAGTGCAAGCCAAATAAAACAAACCACAAAAAAGAAATGGCGGAAGGTAATGGCGAACTGTTGGATGACATTAACC
          AGAAAGCCGATGACCGTGGCGATGGCGAGCGTACAGAGGATTATCCCAAGCTGCTGGAATACGGTCTGGACAAGAAGGTC
          GCCGGCAAACTGGATGAGATCTACAAAACCGGCAAGTTGGCTCACGCCGAGCTGGACGAGCGCGCCCTGGACGCGCTCAA
          GGAGTTTCCCGTCGATGGTGCCTTGAATGTGTTGGGACAGTTCCTGGAATCGAACCTGGAGCACGTGTCAAACAAGTCCG
          CCTACCTATGCGGCGTGATGAAGACGTACCGACAGAAGAGTCGAGCCAGCCAACAGGGCGTGGCCGCGCCCGCAACTGTC
          AAAGGTCCCGACGAGGACAAGATCAAGAAAATCCTCGAGCGCACCGGCTACACATTAGATGTGACGACAGGTCAGCGTAA
          ATACGGCGGACCGCCGCCGCATTGGGAGGGAAATGTGCCAGGCAACGGTTGCGAGGTTTTCTGCGGCAAGATACCCAAGG
          ACATGTACGAGGACGAACTGATTCCGCTATTCGAGAACTGCGGCATAATCTGGGACCTACGACTCATGATGGACCCGATG
          ACGGGCACAAATCGTGGTTATGCATTTGTCACATTCACAAATCGCGAAGCGGCCGTCAATGCAGTGCGACAGCTCGATAA
          TCACGAAATAAAACCCGGCAAGTGTCTAAAAATAAATATAAGCGTACCGAATCTGCGCCTTTTCGTAGGCAATATTCCCA
          AGTCAAAGGGCAAAGATGAAATTTTAGAGGAATTTGGTAAACTTACAGCTGGCCTATACGAGGTAATCATATACAGTTCG
          CCAGATGATAAGAAAAAGAATCGCGGCTTTTGCTTTCTTGAGTACGAGTCACACAAGGCGGCGTCTTTGGCCAAACGAAG
          ACTTGGCACAGGAAGAATTAAGGTTTGGGGATGTGATATAATAGTCGACTGGGCCGATCCACAGGAGGAGCCGGATGAGC
          AAACAATGTCCAAGGTTAAAGTTCTTTATGTGCGAAATCTTACCCAGGACGTCTCAGAGGATAAACTGAAGGAACAATTT
          GAGCAATACGGAAAAGTGGAACGCGTTAAGAAAATTAAAGACTATGCCTTTATACACTTTGAGGATCGTGATAGCGCCGT
          CGAAGCTATGCGTGGCCTTAATGGCAAGGAGATCGGCGCCTCGAATATTGAGGTCTCTCTAGCCAAACCCCCCTCGGACA
          AAAAGAAAAAGGAGGAGATTCTGCGTGCTCGTGAGCGCCGCATGATGCAAATGATGCAAGCGCGTCCCGGGATCGTGGGA
          AACCTGTCGCCGACACATCCTAGCATAATGTCCTTGACGCCCATGCGCCCAGGGGCGCGCATGCCGCTGCGTACGCCGAT
          ACCCCGTGAATACGTAGTCGGTAAACGTAAGTTCGATGGAGGTCACCAAAATCCGGCAGATGTTAAGCGACGTTACCCGA
          GCGGTTTAATAGGAAATGGCGGCAGTTGGGGCAGTTTACCGCTACCACAGCAACCTTTAGGCACCAATGGTGAACAGTGG
          TACATGGATACGTTTTCGGCATGGAGTTAAAACCACACAGCAACCCAATTGAATCATTAAAAGCATCATTAACGGCAACT
          ACAACAACAACATCAACAACAACAGCAACCACACAAGGAAGTTACAGCCACAAAAAAAAAATAAATAACAATCATCTCCG
          AGCAACATCCTGGAGAAGAATCGAATCCTTCGCGTCATAGTAAAAAACACATAGCAACCGTTCTTAAGAGCAATAATTTT
          AATTTCCAAAAACAATATATATGGCATAAGAACCGCAATTAGCAACAATTGAAAAGCATTGTTAAAGAGACTCGTTTCGA
          ACTTAGTTCTTTAGCTATGAACGCCGTAGATTTCGTCCCTCAAAGTAACCATAAATCAAGTCAAGAAATCAAGAAACAAG
          AAATCAGCAATAGCAGCAAACAAAAAATATGTCGAGTAGAGTATATGTATTGTATTGTATGTAATCACTAAATAGCCCTT
          GCAGCAGAGCATTTTAAACGAAATCCTTTGATTTAGCGAAACCACAATTTAGCAGATTCTCCCGAGACATTTTTAAAAAG
          CGTCAGCCTCAACACTTAGATAAACCAAAGTCAAATCGTTTTAAAAGTTCACAAATGTATAAGGAAATTTGTCTCATAGC
          GTTTTTAACTCGAAATTGAAACAATAATTGAGCATATAACAAAACCTATAAGAAAATTTCAAAGTATAAAATATATTTAT
          CTATAACTATATAGAGAGAGCAGTCTAAGCCCGTACAGATTGATTTTAAATCTTAAGCAGCATGTAGCACCCTTTTATAC
          ATTGAACAAAAAAAAAAAAAGAAAAAGAATACAAAAGCAGGCAAATTCAAAATCAATTCGACTCGAAGACATTTTACTAC
          ATTTATATGCGTACTGGAAAATTGCGAGCGCTGAAGCAAGATACATATTTGAAAGCACATATAGACAGACAGACGAGATC
          AGGCTCAGAGGCGCGTTGAAAAGCAAAGCTTAGTGAGGAACATTGACTGACAAAGTAAAAAGTAAACAAAAACAACAAAT
          TATTAATTAGATGGAATGAGAACGATAAGCAAATACAAAAATTAAAAACGCAGCCAGCATTGTTATACAATGCGACTGGC
          GACGGCAACTGGCAAGACTTTCTCTGCATAAATTTGAAAAACGACTATTTTTTAACAACGTAAGTTTTAGGCAACTTCGA
          AAATCAATTATCTGTCGCAAGTAAACAAAAGATACGATACGTAGAGCTAAGTATTGCACACATACAAAACTACACTTAAA
          CTCACTGATAATACTGATAACTGATAGGGCAGATCAAAATCGCAAATCAACAAAATGTGACTAATGTCTGCGAATCGAAG
          AAGCAACGAATTAGGAAGACGGAGTAGACAAAACACACACACATCACGAACCAGTAATATAAAAAAACCTAACGTAAATT
          GATTATACATTTTAATAAAACACTAACGCATACTTAATATTAACACGTGAGAACTAAAAACCATAAAATCAATTAGCCAA
          CGCTCAAGTGCGAATTAGCAGAAGACCTAAAACAGCTAGGAATTCAATTAAAGTCCTCTTAACTAATATCAAATTCAGAT
          TAAACTCTTTTCCCACTTTCCTTTACTCATCTATAACTGGCTACGCACACAGAAAACACTAAGGATTAACTAAAAATATA
          TCAAGCTGACTTGCTAACTTAAACTAGCTCCATGCCTAAAAAATTAAAGCCACACACGTGTCAAAATACGTTTATAATCG
          TATAGGGAAAATTATTGAAACAAACTTGCCCGTTTTCTGTTCTATTTTGCAAAATTTCGACAACAAAATTGTTTGGTTGA
          AGACCGAAGAACCCTGTCGTTTACGTTTCCGCTATTGCTAGATCTCAAGTAAAGCAAAAAGTTAATTAATATATATAAAT
          GTAAAAAACAAAATATATAAATTAGTTTTAAACTAACGAATGAATACTTCCAATTTTGAACTCAAGTATAAAGCAAAATA
          CAAACTGTTGGCAGTTAATGAAGACGCGTGTGTTTTAAAACGTATCTATGAACATTGTTCAGCATAAGCCTAAAACAATA
          ACTTTTTTAAATTTAAATTACACAGACACAGACACACAAAAACACACACACCAAACAGTTGCCTAAAGTAAAAAACAAAA
          ATAAAACAAAAGAAAACAAATTGAAATGAATTAAATAATGAATTAAAACTTGCGCAAAATTTGCCAACCAGCAAAGAACT
          TTAAATACATAATATTAGCCGCAAACAATAAGAGAATATATACAACAAATTCTAAATGACCATAGTTAAGCTTAAATTTA
          GTAACACTCACATACACACACACTCACACACACATATACACATAATTATTAAAGTAAAGTAAACTGTCGTTGTAGGGGAT
          GATGAGAAGTGTGCGCCATTTTCTAACTACAATAACAAGAGACAAATTACTAAAATTAACTACTTACCCATTTTTTATGT
          TTGATAAGTTTCCTTATGAGTTTCCTTGAATATTTTACCATTTTTTTTTTTTTTTGAGAGAGAGCATTTCACGCAACTGC
          AATTGATTGTTGCCTTCGAAAAAGAAACGGAGAAGTAATTTTAAAACTTTAATCATTTTTTTCTTAAACACACACAAACA
          CAGCAGATAAATTAATTTGATAAGAAAGTGAATTATGAAATTTCTATAACGCCGCGTCTTTTTGCATGCAAAATTTTCGA
          CTTTTCGCCCTGAAAATTTCCACATTTGGTGACTTAAAACCTTTGAACCCAATTCAAATTGCAAATATATAAATATAATT
          AATTTTAACGATTTGTTTAATTCGATAACTGTACTGATTTTATATTGTTTTAAATTTGTAATTTAATTTGTAAGTTTTTA
          TTGTTAATGTGTTTTTTCTATTGTAAACTAAAACTAAACTAAATCTGTAACCCAATTGGCAAATTGTTACACAATCCGTT
          CAAGTTTACCGATTTCGATTCGAAAAATTGAGTGTGAAATTTTTTACCTAAAACCATGTGCCGTTATTTAGAAAACATTT
          CTTTGGAAGCCCAAATTTTCCTGCAAGACCAACCGCCCCTCCCTTTCCCTTGACCCAATACCTCCCAAAACCCCTAATTG
          TGTTAAATATTGTAATTTGTAATTTTTGTTTTCATTTTTCGGGAAAGCAAAAACGTTTGGCAAAATTAGTTTTTAATTTG
          AATATTTAGTTTTGTTTGTGCGCTTAAGTTTTCAATAGTATGTTATATATATTAAACTATGAATATTAATTTTTAGCAAA
          ATATTTGTACGACCTAACATAAATCACTAATGTTAAATACTTAAAGAACTAATTTGTTTAGCTGTTTAATTGGTTTAAAA
          TCTTTGTGTATTGTGAAGAGGAGCGCAAGCGAAATTTTTTCTTTCATCTAACAACAATAACAATACGATACCAATAACAA
          TAACAATAATTGTATACGTGTGTAAATTTCAACCTTTAACAAAAGCAACACAATACTGAATATACATAAATAAACAGAAT
          TAAAATCGAGAGGAATCATGAAAGAAAGAAAAGAAAGCAAGGTGGACAAAAAATTGCAAACTGCGCATGGAAACTGAGCG
          AAAAAAATGAAAAACTTTACATGAATTGTGATGATGCAAAGGCAAGATTTAATCATAATTACTAAATCTATATATACAGT
          AAATATATATATCTTTCTCTATAAATATATATATTTGAGTATATAATGTATATGTAGGCGTAGGAGTGTATAATCTAACT
          TTACTTTTAAACAGACTGCGTACGTATTAAAAATTTTTAAAATTAATTTGTGTAAAATGTTTTAAGTTTTGAAAAATTGG
          CAAATAAAGAAAACAATAAAAATTAATAAATCAAAAACACGATTGTATTGTAAATTGAAATATACACACCACCATTTCGA
          CCTATTCCAAATTATTCCTATTCCACACCTTTTCAGCAAACTGAATCGTTTCATGTATATTTCAAGAATCGGCTTAATCA
          AGCGCACCTGTTTATAAAGAAAGATGAAGGACAGTGGCAGTGGATGCAAGGATCTAATACCTTTGGAATGTTTCCAAGAT
          TGTTTCTTCTTGATACACAAAATAGGGAAAACAAAGCACTCGATTTGATTTGCATTAAGACAATATCTGTCTGTTTCAGG
          CATACTTGCACACACGTTAGGATTAACTTTCGTAGACCATTTATGTTTTACTTTAAATTTATAGTTTGTGTGTGTTTTCT
          TGCTCTTTTAATTACATATACCTATACAATTATACTTGATTGATTTGATTTTAAACCCCCTTTTATAAACAACCAATTGA
          TATACAACATCACAAAACATTTGCATACACATACCACACGTATGAAAGGGATTCATAAACCGTGAACGTAACGTCGCCAA
          TTATTACGAGATAAAAACAAATGGAAATTAAATAATAAAAATAAACAATCAGAGTTCATCGTAGAGGAAGGCCGAATGTG
          AGAAAAATGGGAGAACAACTTTTACGTCTTAATAAACAATTATTGTTAACGAAGAAAATAAATGAAATGAAGCATATTGT
          ACTAAAATATTTGATATACATACATTTGTTATTATTTGTAATACGAAAATTAAATAAAATTGCATCCAGATAAT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0083958
          2301
          FBtr0083959
          8675
          FBtr0083960
          2740
          FBtr0083962
          3146
          FBtr0083963
          6543
          FBtr0113256
          2214
          FBtr0334711
          3123
          FBtr0334712
          2610
          FBtr0334713
          7374
          FBtr0334714
          2837
          FBtr0334715
          3407
          FBtr0334716
          4732
          FBtr0334717
          2862
          FBtr0334718
          3397
          FBtr0334719
          2610
          FBtr0334720
          4448
          FBtr0473514
          3407
          FBtr0473515
          3145
          FBtr0473516
          2884
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0083368
          529
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0083365
          563
          FBpp0083366
          711
          FBpp0083367
          529
          FBpp0083369
          707
          FBpp0083370
          571
          FBpp0112168
          534
          FBpp0306763
          603
          FBpp0306764
          761
          FBpp0306765
          753
          FBpp0306766
          711
          FBpp0306767
          699
          FBpp0306768
          665
          FBpp0306769
          611
          FBpp0306770
          665
          FBpp0306771
          761
          FBpp0306772
          569
          FBpp0423032
          699
          FBpp0423033
          670
          FBpp0423034
          678
          Comments
          Extended 3' UTR based on RNA-Seq and/or EST data.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG17838-RF
          Syp-RF
          Secondary FlyBase IDs
            References (2)