Open Close
General Information
Symbol
Dmel\Syp-RD
Species
D. melanogaster
Annotation Symbol
CG17838-RD
FlyBase ID
FBtr0083962
Feature type
Associated gene
Evidence Rank
Length (nt)
3146
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 49 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
    Sequence
    ATCGATGCGTAGTTGGCCCTGCTGGGCGATTGTCAAAAGTTATTCCGTAATGTTTTTTGTTTCTATTCAGTTGTGAAAAT
    TTTTCTCGTCTCTCGAATCGTTTCGGAACTATTGATTTTTACTTCAAAAATAAGAAAAAGCGAAAACAAATTCATTCACA
    TTTGCAATCGAAATTCCAAGTCGCCTAAGGAAATTGAAAATTGTTAAATTGTTGCATTACGCGATGCTTTCCCAGATGGA
    AGCCTCCAAAGTGCAGAAGGATGAAGGGGGCGGCGAGGCTCTGAGCCGCACGATCCTCAAAACACCGTCTTCATTCAGGA
    CCCCCAGCCCAATTCCCAGTTGCAGCAAAATGGCGGAAGGTAATGGCGAACTGTTGGATGACATTAACCAGAAAGCCGAT
    GACCGTGGCGATGGCGAGCGTACAGAGGATTATCCCAAGCTGCTGGAATACGGTCTGGACAAGAAGGTCGCCGGCAAACT
    GGATGAGATCTACAAAACCGGCAAGTTGGCTCACGCCGAGCTGGACGAGCGCGCCCTGGACGCGCTCAAGGAGTTTCCCG
    TCGATGGTGCCTTGAATGTGTTGGGACAGTTCCTGGAATCGAACCTGGAGCACGTGTCAAACAAGTCCGCCTACCTATGC
    GGCGTGATGAAGACGTACCGACAGAAGAGTCGAGCCAGCCAACAGGGCGTGGCCGCGCCCGCAACTGTCAAAGGTCCCGA
    CGAGGACAAGATCAAGAAAATCCTCGAGCGCACCGGCTACACATTAGATGTGACGACAGGTCAGCGTAAATACGGCGGAC
    CGCCGCCGCATTGGGAGGGAAATGTGCCAGGCAACGGTTGCGAGGTTTTCTGCGGCAAGATACCCAAGGACATGTACGAG
    GACGAACTGATTCCGCTATTCGAGAACTGCGGCATAATCTGGGACCTACGACTCATGATGGACCCGATGACGGGCACAAA
    TCGTGGTTATGCATTTGTCACATTCACAAATCGCGAAGCGGCCGTCAATGCAGTGCGACAGCTCGATAATCACGAAATAA
    AACCCGGCAAGTGTCTAAAAATAAATATAAGCGTACCGAATCTGCGCCTTTTCGTAGGCAATATTCCCAAGTCAAAGGGC
    AAAGATGAAATTTTAGAGGAATTTGGTAAACTTACAGCTGGCCTATACGAGGTAATCATATACAGTTCGCCAGATGATAA
    GAAAAAGAATCGCGGCTTTTGCTTTCTTGAGTACGAGTCACACAAGGCGGCGTCTTTGGCCAAACGAAGACTTGGCACAG
    GAAGAATTAAGGTTTGGGGATGTGATATAATAGTCGACTGGGCCGATCCACAGGAGGAGCCGGATGAGCAAACAATGTCC
    AAGGTTAAAGTTCTTTATGTGCGAAATCTTACCCAGGACGTCTCAGAGGATAAACTGAAGGAACAATTTGAGCAATACGG
    AAAAGTGGAACGCGTTAAGAAAATTAAAGACTATGCCTTTATACACTTTGAGGATCGTGATAGCGCCGTCGAAGCTATGC
    GTGGCCTTAATGGCAAGGAGATCGGCGCCTCGAATATTGAGGTCTCTCTAGCCAAACCCCCCTCGGACAAAAAGAAAAAG
    GAGGAGATTCTGCGTGCTCGTGAGCGCCGCATGATGCAAATGATGCAAGCGCGTCCCGGGATCGTGGGAAACCTGTCGCC
    GACACATCCTAGCATAATGTCCTTGACGCCCATGCGCCCAGGGGCGCGCATGCCGCTGCGTACGCCGATACCCCGTGAAT
    ACGACTACTTTTACGACTTTTTCGGTTTCTCGGACTATCGCCAAGGGGGGTCCTTTGGCAATAATGTGTCCTACTACGAT
    GACATGTACCGCTGGATTGATGGGGATTACAACTACTATGATTACCCGAACGGTGGCGGCGGGGGCAGCGGGGGAGGAGG
    AGGTAGTGTGTCCGGCGGTACGGTGCTTCCGCTCTCGGCCGGCGGCTCCCAGAATTCACCGATGGCTAGTGGACAGCGAT
    CGGCCAGAGGATCGGCCAGTGGTCCCAGTGCTTCCCCGAGCCTTATGGGAGTTGGTCGTGGGCATGGAATCACAGTACCG
    CGTGGCAGAGTCGTTGGCCAACGTGGCAGCATCAGTCGTCTGGGGGCCCAAACAGTGCCACAGGCGGCGGGAGCGGCAGC
    GGCGGCGGGACAGGCGGCGGCGGCGGTAGCTCAGCGGGGGGCCACCGGTCAGGGGGCGCCGGCAGCAACCGGGGGGTTCC
    GTGGGGTGTTGCCAACGCGTCCCAGCGCTCGTGGCACCCAGCACGTCAAGCCGCTACAAAATTTACCAGCTGGAGCTGCA
    TTCAAAACATTCATGGAGGGTAATTAAGCGTAGCTCATCGGCCACCTCCTTGGACAGCGACAAGAGTCGCTCTCCGGGGA
    AGAAGCGTAAAGTCCATAGGTCACATAACAAAAACAAGTCACACAAGTCTAAGAAGCATGCCCACAAGTCCAAGTCGTCT
    CGGCCCGATAAAGAAAAGAAATCCAAGCGGAAGTCCGAATAAAACTTTGTAACCAGACCATATCATATCATCTTCCTTTC
    GAAATCAAATCCAAACGAAGAATCTCGTCATTGGCAATCGAGGCAAATTCAAGAACACTAATCAATCATCACACATCCCG
    CATCTTTCAAGCATCAAAATCCTTAACGCCAGATCAGATCAGTTCAGTTCAGCCTCTGAAAGTCCTTGCAAAATTCCAAA
    TTTCAAACTAGGAGTGTACGACCACACACTTATAGATACACGAAGAAGTCCCAAGTCTTTCAAGTACAGCGCTCTGTTCT
    CCTCCCGTCCAGGGATCCATAGATCTGGCAGACGATCCTTTTTATTACACTGCCCCATTTATCGCCGCTACCCATCAGTG
    TTCCATGTTTCATGTGTCAGGCGATAATATCATGTACAATGTTTTACTTACAAAATGAACACGTTTGGTAATTGTTAACA
    CCACACACACACACACACACACACTATATGCACTATGTGTTAACATCATAGTCACACACCCCAAACACCATATATTTGTA
    AATGTAACAAGTCCTAAGTCGTCCCTGGCGTTATGTCGAGTTAACACAATTTCCCGATTTGTGATGTGTATAAACAATGA
    TGAGATAAATTAAACGAACAATGATC
    
    Other Products of this Gene
    Other Transcripts
    Name
    FlyBase ID
    Length (nt)
    FBtr0083958
    2301
    FBtr0083959
    8675
    FBtr0083960
    2740
    FBtr0083963
    6543
    FBtr0083961
    6794
    FBtr0113256
    2214
    FBtr0334711
    3123
    FBtr0334712
    2610
    FBtr0334713
    7374
    FBtr0334714
    2837
    FBtr0334715
    3407
    FBtr0334716
    4732
    FBtr0334717
    2862
    FBtr0334718
    3397
    FBtr0334719
    2610
    FBtr0334720
    4448
    FBtr0473514
    3407
    FBtr0473515
    3145
    FBtr0473516
    2884
    Polypeptides
    Derived from THIS transcript
    Name
    FlyBase ID
    Length (aa)
    FBpp0083369
    707
    Derived from OTHER transcripts
    Name
    FlyBase ID
    Length (aa)
    FBpp0083365
    563
    FBpp0083366
    711
    FBpp0083367
    529
    FBpp0083370
    571
    FBpp0083368
    529
    FBpp0112168
    534
    FBpp0306763
    603
    FBpp0306764
    761
    FBpp0306765
    753
    FBpp0306766
    711
    FBpp0306767
    699
    FBpp0306768
    665
    FBpp0306769
    611
    FBpp0306770
    665
    FBpp0306771
    761
    FBpp0306772
    569
    FBpp0423032
    699
    FBpp0423033
    670
    FBpp0423034
    678
    Comments

    Transcript terminates at site supported by polyadenylated cDNA.

    External Crossreferences and Linkouts ( 1 )
    Crossreferences
    RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
    Synonyms and Secondary IDs (2)
    Reported As
    Symbol Synonym
    CG17838-RD
    Syp-RD
    Secondary FlyBase IDs
      References (2)