Open Close
General Information
Symbol
Dmel\SKIP-RB
Species
D. melanogaster
Annotation Symbol
CG31163-RB
FlyBase ID
FBtr0084197
Feature type
Associated gene
Evidence Rank
Length (nt)
5049
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 61 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
    Sequence
    GGTCAGTCGTCGAAATGTTCGAGATCCGGTCGTTTTGAAAACCAGCTCGAGCGGTCTATTCGCGTGAAATTGAAACTGAA
    AAAGCCGGTAAAACTGAAGCAAGTGTGTTGTGATTGAGAATTGAGCGAAACGAAAACGGTGGCCAAACGAGCCGTTTAAT
    AAGCAAACAGGCTGGCCAATAACCAATTACCATCAGCCATGCCATCAAGGAATCGTGATAACGCAGACACAACCGGCAGC
    AATTTGTTAATTTGAAACGTCGTGTGTGTTCCTCTACGAAAAAAAAAACCCAGTTATTTAGCAAGCATTTAAATTGCATT
    TGTAGCATAGCACTTTAGTTGCGCGTAGGAGGAACAGCAAGGTCGTTGGGGTCGAATGTGAATGTTTGTGATGCAAGTGA
    CAAAATCAAAATTGGAGTAAATTGGTAGCCATTCCTGTGAGCATTTTCGCGTCGCGTAACGGTAAATCATTGCGCCCTGC
    GTGTCTTCGTGTGCGTGCGTGTTTGAGTGTACGTTTTTCGGTTTTGTTTTCATCTCCTCCTTGCCATCCTCCTTTCTTCC
    ACCTTCAATTGCCATCTCCTAATTTCCTCTACGAACGGAGAAACACGAAAACGAAAAGTTTCGAAGACCAAAATATTGAT
    GAACTATATTTTTGTACTTGACAAATTTTGAATTCAAAACAGACACTAGCGCACAAAAGAACCTGTCATTTAGAACATAA
    GAGGAGCAATGCGGCGAAGCGGTGGCGCCAAACAAAATGTGAGGATAAACCAGCGTTGGAGCCTTCTGGGATTATGCTAA
    AAATGCTCAAAGTGCAATATAAATTTTTATGAGTGTACGCGCTGAATTTTTACGACTGTCTGGGGGCGGGGAAAATAAAT
    TAGAGAAAATGCCACAGGGAGGACGATTTAAAACAATACAATAGCTTAAAGTGGCAAACGGAAATTGCATGCAACCAGGA
    GGCGTGGCACTGTACGCCCCCCGAGCACGTGACGCGCACACCAAGCCAACAGCGAAACTAATATAAGCCATTTTGTAGCG
    CTAATTCGCAGGACACACGTAAACGCAGCACAGCTACGTCTTACGTAAAAACACCACCCATCTGACACTTGGAAATCAAG
    CAGAAACCATACACTCACCTCATCATCATCATCATCAACATGGCCGTTAGCAATATTGTCTGCGAGTGGCTAAGAGCTTT
    GGGCCTGGCCCAATACGCCGAGAGCTTCCTGGACAATGGCTACGACGACCTGGAGATCTGTAAACAGGTCGGTGATCCCG
    ATCTAGATGCCATCGGCGTCGAGAATCCTGCCCATAGACACAAGCTGCTCAAGAGCATCCGATCGCTGAGGGAAAAGGGC
    GCCGCATCCGTTTACTTTATGCTCAACGATCCCAACTCGCTCTCGGGCAGCATGGAGATCCTCTGCGAAACACCACCCAA
    CAACGAACTGGAGCTCGTCCTGCGGGAGCAGCTAGAGACGGACGGAGTCCGGCTGACCGCGCATCCATACTCAACACCGC
    CCTCGAGTTGTCTGTCCGACAAGGAGGAGGATGAGATTTACGGATTCGGCTATGGCGTCTTCGCACCCCGCGTGGCCAGA
    GGAGGGTTAACACAACAGCAACAGCTGCTGCAGCAGCAGACGCTGCAAACGCAACAGAGCATACAGCAACAGCAGCAGCA
    GATGCAACAGCAGCAGCAACAGTTACCAATTGTGCCAGGACAACAGCAGCAAGGACCTCATCAGCATCAGACCCTGCCAC
    CGAATGTCGCGCATTTGAACTTTGTGCAGCAAAACTGCCTGAGTCCGCGCTCAGCTTATTTCTACGAATTTCCACCGACA
    GCTGAGGGCCGCGAGACAAAGAAACGCACCACACTGGCCCGGCTGCTGAAAGGCTTGAAGACTGTCAATCGACGGGATCG
    GAACAATCAACAGAATGGCGCCCAGGCCAGGGCGGCTAACGATCGTCTGCGGCACTTTCAAATGATAAACGGCGGCGCCG
    GCGGACAGCAGCACAGTTTCGAGGAGACAATCCACAGGTTGAAAGTACAAGAGGCCATGCGGAAAAAGGAAAAATTTCAA
    CGTGAACACGAGGAGATCCTGCGTGATATTCGACAGGGACTGTTGCAAATGAGTCGCGGCGAAGGACGCATGGACGATAC
    GTATATGTACGACGAGGCGCTGAGAACGGGTGGCGGTATGGGCATCGCCGGACTGGGCATGCCACTCGGTGTGGGCGGCA
    ATGGTGGCGGCGGGGGAGCAGCCCATTATGCGGTGAGTGCGCTGCATCATCAAGGTCATTGGTACGACGAGCCGCCCTAC
    GAAAGCGATCCCGATGACTTTCTTATGGCCGGGCTCAACTGCGGACCAGCTGCCACAATTCAGGGTGGCCGTGTGCGCTT
    CTCGAACAACCGCGAGAGCACAGGCGTAATTTCATTAAGATCCGCCGGAGATATTTCATTGCCGCAACGTGGACCGCCGC
    GTAGAGGTCTTATCGTGCCGCAGCAGCCGCCAAATCCACCGACAATAATACCCTTAACGCACGCCAGATCTCATGATCGC
    GAAAGCGGCGACTACGCGGGCTCCATCTCAGATCTACAAAGCGTTACCTCCAGATTCAGTACGGTGTCGATTGGCACCAA
    CAACTGCACGGCCCGCTATCGAACCCTAAGCGGTGGAATTGGGGAATCACCATCGCTGTCGCCCAGTCCATCGTCGGATT
    ACGAGGACATCGGAGTGACCAGGGGCCACGGATGTCTACCGCCCAGCCTGCTGGCCGCTAAGGCCAAAAAGAACGGACTG
    CCGCACGGCAAGGCGAACACCATTTGCCAAAAGGCCACGGTGCATCATTCGGGCGAGATGCGTAGCTCGGCAAAGGAAAT
    TGGCGCATTTAATGAGAATGGACGAAACTTTGTTGCCACAAAGGATACGTCGAGGGATTTCAGCAATTCCCAAGATAATA
    CCGACCGTGGCAGCATGAGCGATCAGGCGTTCGCCTGTTCGGCCAGCTCCGTGGAAAGTTTGCCCAGCGCATCCGGTTCG
    AGCACCCAGGCTCTGGTTCGTCCTGGCAGTCCGCACAGCTCGATTTCGGCCGAGGATCGCACCTCGATGGCCAGCTGCAT
    CTGCAAGGCCAAGGCTCTCGTGGATAGTTTGCCCAATCCCTACGATAAGGAGGCACTCAAATTCAAGAAGGGCGACCTTA
    TCGATGTGCTGTCGATGAACGCCTCGGGCATTTGGAAGGGTCGATGCCACGGCCGCGTGGGCCACTTCAAGTTCATCAAC
    GTGGAGGTGCTGCCGGAGCAGCGAATGAAGAACTCCAGCAGCAAGACCCTGGCCGCCGGCTCGCGTTTGGCTAATTCTGG
    AAATGGCAGCCACAATGGTGGACCCTGCTCCGTGGAGGACCTGCTAATTCGCATTGGACTCAAGGAGTACACCTCCGTCT
    TTGTGCTCAACGGCTACGAGGACCTGGAACTGTTCAAGGAACTGGAGCCCGCTGACCTGGATTACCTGGGCATTCTCAAC
    CAGGAACATCGTGCCAAGCTGCTGACGGCTGTGCAACTGCTGCATGACATTGAATGCTCCGATGTGGATATACCCGGATC
    CAGCTCGGAAAATGATGAAGCCCGCCTGAACAACATCAATATGAAGCATGGAGCATCGCCCTTTGGTCGACGCCACTTTC
    CCCGCGACTCTGGATGCTACGAGGGATCCCCGCTACCCAGCTCACAGACACCTACCCAGGCGGTAAACTCGACGGACGAG
    TCGAACAGCTTGGACGACGTGGTGACCAAGTGTTCCAGTGAAATTATGAAGCGCGTGGAGAGCGCCCGCCGTTGCAAGGA
    CAATCCGTTCAAAACCACTCTGCCCGGCGGAGGACGACTGGGCAAGAAGTCCTTTCTCGGCGGCAACGGCCTTATGGCGG
    ACGATACGCTCACGCGTGGAGGGCTTAGCGAGAAGTCGAGCGATTCGGGGGTCAGCAGCAGTTCGCTATCGTCGGGTCCG
    CTGAAGAGCAGCACTTAACATTTGCCCACCATACTGGCCCACGAGTTGCTGCTGGGCGTGGGCTCGGGCATGGGCATGGG
    TCTTGGTCTTGGCACCATGAGTCATGGCACCACAGGTACCCTGACGCCCCACGGAGTGGCCACTGCCACCTCGCCTACCG
    CCCATTCGGCACCGCTGGGTAACATCTGCAACACGCTGCCACATGCACCAAGCTCCTCAGGCGGCGGCGGCGTATCTTCC
    TCCATGGCCAGCAACCTGCCACTCAACCGGAATCTGGTAATGCTGCGCAATCATCTGCGCAAGAATACGGGCGGTAGCAT
    TACCGGAAATGGCGGCGTAGGAGCTTCCGGTGTTGGAGCACAGCTGCTGCAGGATCAGGACGACAGACTGGAGGATCAAT
    AACCCATTTACTACATCAAATTCTTAGTTTAGTCTCCCATTGAGTTAAGTGTATTTCAATTGCTGTGATTCGATAGTGAA
    AACAAAAGGCCAACATGCGTCTTTCAGTTCAAATGTATAGTATGTATAGAGAGAGATAGACAGACAGTTAAGAGAGAGAC
    CGGTATAGTGGGGGATGTGTTTAAAGGAAAGAGAAAGATAGCAAGCAGAGATAGTAAGAGTCAGTCAATCCTTCCTCCGA
    TAATGTTGGCATTTACACAAATATTTAACACTTATATAAATACAGACTTTACAGACTTATATATACATACACAATCTGCA
    GAAAAGGAGAAATTTTATATACTTAGTGATGTAATGAAAATATTTATATATTTTGACTATATTTTGATTTTTAGTTAGTT
    TGAAGCTATGCATTGAATGAGACTTGTATGATTTGCCATTTTATTACTGTTTAATTGCTTTGTGTATGCATATTTCTCAA
    CGTGATATTGTCAAACGTCCAACTTGAATTGCATTTTAAATAGATTCATTTCTAACATTTTAATAAGAGACACACATAGA
    AGTTGATTCCTATTTTAAGGCACTAATCTGAGTGCAAGCAATAGACCAATTCAATTTTAGCAACCAAGCAAAACAAAATA
    TTTATAAAC
    
    Other Products of this Gene
    Other Transcripts
    Name
    FlyBase ID
    Length (nt)
    FBtr0301028
    5788
    FBtr0305036
    6584
    FBtr0305037
    6489
    FBtr0310203
    508
    FBtr0330381
    5049
    FBtr0336712
    6669
    Polypeptides
    Derived from THIS transcript
    Name
    FlyBase ID
    Length (aa)
    FBpp0083595
    952
    Derived from OTHER transcripts
    Name
    FlyBase ID
    Length (aa)
    FBpp0290250
    1064
    FBpp0293573
    1064
    FBpp0293574
    1034
    FBpp0301887
    128
    FBpp0303407
    1080
    FBpp0307693
    1027
    Comments

    Transcript terminates at site supported by polyadenylated cDNA.

    External Crossreferences and Linkouts ( 1 )
    Crossreferences
    RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
    Synonyms and Secondary IDs (2)
    Reported As
    Symbol Synonym
    CG31163-RB
    SKIP-RB
    Secondary FlyBase IDs
      References (2)