Open Close
General Information
Symbol
Dmel\unk-RB
Species
D. melanogaster
Annotation Symbol
CG4620-RB
FlyBase ID
FBtr0084403
Feature type
Associated gene
Evidence Rank
Length (nt)
2717
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 97 )
Sequence
TTGCACATCACTAACAACGATGTTGGCAAATGAAACGAACAAGCTGCTGCTTTCCTCGCAGCAGGAAAAACCAAATCACT
ACACCTACCTGAAGGAGTTCCGCGTGGAGCAGTGCCAGTCGTTTTTACAGCACAAGTGCAACCAGCATCGCCCCTTCGTC
TGTTTCAATTGGCATTTTCAAAACCAGCGTCGGCGTCGTCCAGTGCGAAAACGCGATGGCACCTTCAACTACAGTGCGGA
TAACTATTGCACCAAATACGACGAGACCACTGGGATTTGTCCCGAGGGCGACGAATGCCCCTACTTACACCGCACTGCTG
GCGACACCGAAAGGCGATACCATCTGCGCTACTACAAGACATGCATGTGCGTCCACGACACCGACAGCCGAGGATACTGC
GTCAAGAATGGACTACACTGCGCCTTCGCCCACGGCATGCAGGACCAGCGCCCACCGGTTTATGACATCAAAGAGCTGGA
GACCCTGCAGAACGCAGAGAGCACACTGGACAGCACTAATGCTTTGAATGCCCTGGACAAGGAGCGCAATTTGATGAACG
AGGATCCCAAGTGGCAGGACACCAACTACGTGCTGGCCAATTACAAGACAGAGCCCTGCAAGCGCCCACCGCGCCTGTGC
CGCCAAGGATACGCTTGTCCACAGTACCACAATAGCAAGGACAAACGTCGCTCGCCCAGAAAATACAAGTACAGGTCCAC
TCCTTGCCCCAATGTCAAGCACGGCGAGGAATGGGGAGAACCGGGCAACTGCGAGGCCGGCGATAACTGCCAGTACTGCC
ACACACGCACCGAGCAGCAGTTCCACCCGGAGATCTACAAGTCGACCAAGTGCAACGATGTCCAGCAGGCCGGATACTGT
CCGCGCAGCGTCTTCTGCGCCTTTGCCCATGTGGAACCTTGCTCAATGGACGATCCGCGCGAGAACTCATTGTCGGCGAG
TCTGGCCAATACTAGCTTATTAACACGTTCCTCGGCGCCAATTAACATTCCTAATACGACTCTAAGTAACTCAATTAACG
ATTTTAACTCAGGTAGCTTTGCCGTCAACATTCCCAGCAGCTCGCTCACCTACAGTCCCACCAACCATGCCAATCTCTTC
AACGTGGACGCCTTCAACTATGGCGGCTCAAACAAACTCAGCAATTCCCTTTCGGCCACCCAGAACGATAGCAGTCTCTT
CTTTCCGTCGCGCATCATATCGCCTGGCTTTGGCGATGGCTTGTCGATTAGTCCTTCGGTAAGGATATCCGAATTGAATA
CCATACGCGACGACATCAACAGCAGCTCGGTGGGAAATAGTCTGTTCGAGAACACTCTCAATACGGCCAAGAATGCGTTT
AGCCTTCAATCTCTGCAGTCGCAAAACAACAGCGACTTGGGTCGCATCACCAATGAGCTGCTCACGAAGAATGCTCAAAT
TCACAAGTTGAACGGACGTTTCGAGGACATGGCATGCAAGCTAAAGATCGCGGAGCTCCATCGGGACAAGGCCAAGCAGG
AGGCGCAGGAGTGGAAGGAGCGCTATGACCTAGCACAGATACAGCTAAATTTGCCAGCAGAGCTTCGGGACTTGTCCATA
CAGAAATTGAAGCAATTGCAGTCCAAGCTGCGCACCGACTTGGAGGAGGTCGACAAAGTATTATATTTAGAAAATGCCAA
GAAGTGCATGAAGTGCGAGGAGAACAATCGCACGGTTACTCTGGAGCCGTGCAACCACCTGTCTATTTGCAATACATGCG
CTGAATCGGTCACCGAGTGTCCCTACTGTCAGGTGCCGGTAATAACCACCCACACCTAGAACATGTTTTATCAGCAACAG
GACCACAAGTGGCCCTTTGGCTGAAAATCGGATAGGGATGGGAAAGGGGATTCCGATGGGATATGAATGGATCATGGGGA
TCAAGACCGCGAACAGCATGACAATGTGGTACTCACAAAGCAAACTTTAGTCTTAAGCAAAACGTTGAAACTTTTGAACA
GTTAGGATTTGACACATGCCTACTAATTGTGCATGTGGCAGGGAATATATAATTTATGTTTTCAATCTACTCAAAATATG
CAAATTATCGTCATGAATATTAGTAATTACTAGGCACAAACTATTAATTGAATTAGCTAGCTGCTCTAAACGAATAAGTA
TGTAATTTTATTTTTGTTTATTTTTTCTCATATCGAATCGAATACAGGAAAAAACATTTTAAATTGATTTTGTACTATGA
TTTATGTAACCAACTCTTTTAATTTTGTTTAATATTCAATGTTTAGGCATACATATTTTCTAATCTACTGCACGAATTTG
CAATGTCTCATTTATTTTTTTTTTAACCACATATGTATCTCTATATTTGTATTTAAATATGCTACACTTTCAGTCATATT
GTACTTTTCACTAGTATTACATAAGAAATTATGAGAACTAAACAATTACAAGATGTAATTGAATGAAAGATATATAAATA
TATAATATATTAATTTTTCTAGACACTTTTAGCAATTGACTATTAACAAATTTATAGAAACCAACAAATTTAACAATATA
TTGTCGCATAGAAGAGCAGAAAACAACCACAAACAAACAAATACCACCAGTGATTTTATATAAGCCGATTTTCAAACTGT
ATTTTTTATGTATGTGTTTCAAACTTGTGAATGCAAACTACAACTAAAAGCCAAGACAATGGTCATAAAATCAATGT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0084402
4195
FBtr0305571
3667
FBtr0305572
3886
FBtr0305573
5518
FBtr0337052
6109
FBtr0347570
3889
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0083795
599
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0083794
599
FBpp0294022
599
FBpp0294023
672
FBpp0294024
599
FBpp0307981
600
FBpp0312602
673
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG4620-RB
Secondary FlyBase IDs
    References (2)