Open Close
General Information
Symbol
Dmel\CG31365-RA
Species
D. melanogaster
Annotation Symbol
CG31365-RA
FlyBase ID
FBtr0084406
Feature type
Associated gene
Evidence Rank
Length (nt)
2335
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 67 )
Sequence
AACCTGTCTGCGGTCACATTGCTTGCGATGCAGAGACGCCACCGAGTAAATACGTTGATTTACCAAAAATAGACGCCTTC
ATGGATGCACAGCCGTCGTATCCCGATTTGGCGACCCTGTGCCGCCTTTGCCTCAAGGAGCACCAGGATGCGTACGCGAT
CTTCGACGAGGACGACACCCAGCTCTCGATACCCGTGCGCCTGATGGCCTGCGTCGCACTGGACGCCAAGGCGACGGATA
CTCTGCCGAAGAGGATCTGCCAGGAGTGCCGCTATCAGCTGGAGAAGTCATTCCTGTTCCGGCAGCGCTGCCAATGGGCG
GAGAAGAAGCTTCGCAAGCATATCCGACTTCTGGGTCTCGGGAAGCGAAGCCGCGTCTTCTCCAAGGATCCGGACGATTA
TGACGAGGACGAGCTGGAGTTCGAGGACTCTATTGCCTTCATCGAGGTGCAGGACAAAGTGCGCAAGCTTGAGGACGAAA
AGTGGCGAGAAGATTTTAAGGAAGAACAGGCGGCGGAAATGCACAAACGGCTGGTCAAATCTCGTCTAGAACTTCGAGCG
AAACTGACCACCGAACTGCGCAAGGAACTAGCGGAGGAGGTGCGCAGTGAGGTTCGCAAGGAGCTGGCCGAGGAGGTGCG
CAGCCAGGTTAGAGATGACCTGCGAAACGAGGTGAGCGAGGACATAAGAAAAGAGCAGCTGGCCATGCTGTTGGGCGAAT
TGGAGGTGTATCTTACCGAGAAAAAGGCCGGTCGGTGGGAGTCTTTGGATGGGTCCGAACCAGAGACCAAGCCGCAAGTC
AAGGAAGATGCCTCCCCTTCTAGGTCAAAAACTAAAGCTCTTCCAAAGCGACGACCCAGCTTGGTCGACGCCAATCTAAA
GGCGACAGAGGCCAGGAAGGATGCAAAAGAAGAGGAATTCATATTGGGCTGCAATACCGACCCCGCAAATAATAGCGATG
TAAACATAGATGGCCTCGAACTGGACGAGGAAGTGCCCGCGGAAAGCGGTGAAGACTTCAGGGAAATCAACATGGTTGGA
TCAGATGTAGTGCACACAGACAATGGAGAGATTTACATCATAAACTCTGCCAGCTCAGAGGATCAAAACCAGGACTCCAC
TCCCGAATTTGACCAGGACAACGGAATCACCTCCTATAACATCAAAGAAGACGGCGAAATTCAGTTCAGTGGCGAAAAGC
CAGAGGAAATCGAAGACGTGGTCGTGTTTAATCTGGGCGAGGAGATATCTCAGGAGCAACAGGTCTTCAGCTTCCATGAA
AATGTCATTATAGTGGAAAAAGAACAGAACGATAGAGATGAGCAGACGCCCCTCAAACGAAAGAGATCGAGTGAGTTGGT
GTTCAAGCAGGAGTCCAGTTGTCCTCAACCAAAAACCGGTCGAATTACGGACACGGTGAAGTCGTTCCAGTGCCATTTGT
GCCCGGTGGCATTTCCTACGCAGAAACTTCTGACGCGCCACCACAACACCCACATTAAGGGACTGAAAAGTGGAAAGGGC
GGCACGCTCAAGTGTCCCAGCTGCGCACTGCAACTGTCGTGCGCCAGCTCGCTCAAACGCCACATGATTATCCACACGGG
CCTGAAACCCTTCAAGTGCAGCGAGTGCGAACTGTCCTTCTCCCAGCGCGAAGTGCTCAAGCGTCACATGGACACCCATA
CGGGAGTAAAGCGCCATCAGTGCCCCCAATGCTCGAGCTGCTTTGCCCAGAAGTCCAACCTGCAGCAGCACATTGGCCGC
GTGCATATGGGCAACTCTCGGACGCACAAGTGTCATCTGTGTCATCGTAGCTTCAATCATGTTTCGGGCCTCAGTCGCCA
TCTGGTCACCCACGCTGGCGTCATGTTCTCCTGCAAACAGTGCGGCCGTCAGTTTAACGATCGCAGTGCGGTCCAGAGAC
ATGTAACCACAATGCACAAGGTGAAGAACAAGCTCACAGACTACATATCCGAGACGAACGAGTTTCAAGCTGTGGCCTAG
AATAGTCCCTGGACATGTTTTACCAATACACCGCAGATTGGACCACCATGTTTTACACCTGAAGAGACCAACTTTGATTG
ATCTGAATATTTTACAACTTTATTCGCGAACCTAGAGTGCTCACAACAGTTGGCACCAAAAATCATCAACATGATAGCGT
TAAAACATTTAGAAACATGCAGCATTAAACAGTTTAGCAAACAAATACAAATCGGAACATTTGGAACAGCTCTGTAACAA
GATACATATAGCTAGACGTACATTTTACAATATCGTTTAATAAATACCACATAAGACGATGTACAATTTTATAGGCAAAT
ATACGTATTTTTAAT
Other Products of this Gene
Other Transcripts
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0083798
639
Derived from OTHER transcripts
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG31365-RA
Secondary FlyBase IDs
    References (2)