Open Close
General Information
Symbol
Dmel\tok-RA
Species
D. melanogaster
Annotation Symbol
CG6863-RA
FlyBase ID
FBtr0084690
Feature type
Associated gene
Evidence Rank
Length (nt)
5368
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 33 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CAAATCGCGAGCAACTTCGGTCGTGAACGGACGTGCTTTCGCTGTAAACTCGGAATCGGTGTCGCGAAACAAAAGAATAT
        TGGCAACAAACTTGTTTGAGTCAAATGGCCAAACGCAAATATCCGCAAAGGGCAGCAGGATAAATTTATTGGCCAGTGAA
        GTGAGCCCGGCACGTGCTAATCGAAAATGCAGAAATTATACTAAGAGCAGATAGGTAGGCACATCTCAGTCCAAACGTGG
        TCAGTGGTCACGAAACGAGGAAAGAGCAACAAAACCTAAAATCACAAACCGAAGACTTCAAAGTACACAAGAATTTGAAG
        CCACTGCAATGCGTAGGAGGCGTGGCACGCCCCTGGGCGTCAGCTGGACGAACTGCGTCCTGCTCCTGGCCACCGGTCTG
        CTGGTGGTGCTCATTTCGGTGCACGCCAAGAACCCCAGGCCGCATCGAGGACTACCCGCCCCGGCTCCTGCACCAGTTCC
        TGCATCCGTAGATCAGGTGGCAACTGAAAATGCCCACAGGCGGGAACCTACCGTCGATGGGAGTGTACTTCAACGGCTAT
        CGGGTTCAGATAGGGCTGTTGACGAGGATGAGGATGTCGATGAGGATGAGGATGAGGGGCTAAAGCACCAGCACCTCGAG
        CATCGGCAACAATTTGACGCATATCTGGGCACAATCCGACGGCTGCGTCGTCCATACCGCAGCAAATACACCATCGAGCA
        GCTGATGCGACTGCATGTGACACCAAAGGTATCCGGAGACATTGACATGGATCCCTGCAAGGCGGGCGGTTTCATGGGCG
        ACATTGCCCTGCCGGAGGGTGATTCCGGCCCGGTGGTTGCCCACACGCCCATCGACGACGAGGAGCAGGAGCGCCAGGAG
        GTGGAGCAGCTGCTGGCTGACTCGCCCAGCCCGGTTCACGACCCCCCTTCCGTTTCCGGTGCGGCCAACTCAGGGCCGAC
        CAAGTTCAATGCCACCTTCCAGCTGGATCTGGAGAAGCTCAAGCAGGAGGTCTACCACGAGGGCCTACAGGTGGAGGAGG
        AGGGCCTCACCGACATCATCCGCAAGAAGACCAAGCTGCCCAGCTCAGGTCCGGTCAACCTGAAGGCAGGACAAAGCCAG
        TCACAGAGTCAGAGTGCCAATGAACCCGTGAAGCCCGGTTCGGAATCGCCCTCCGATTACGCGCAAGCATCCAGCTACAA
        GAATGAGGTACTGCCTCCGTCGGAGCAGCGAATCCATACGGACAAGCCGGCACGGTTGACGCTGGCCGAGATTGGACCCA
        AGTTCAGCAACAAGACGCAGTCGCTGCACCGTAATGTGGACACACGCAAGATTCAGTCGGACAACAAGGACATCGAGGAC
        GATTCGGGCAACAATTTTGTGGCCGAGAGGAGGCCGTCACAGATTGTGCCCACTTCCTTGCCGGAGCAGCGATCCACTCC
        GGCTCACGTGTACAGCAATGCCGGAGGCAATGGCATGCAGTTGGACGACGAGGTGGACTTCTTGCATTCCCGTGGAGTCG
        TGAGGAGGCGTCACAGGCGAGGACCAAAACAGCGAAGGAGCAACCAGCACTTGGAGCACGAGGTCAAGCTGCAGAGATTG
        AGGGAGGAGCTCAGCCGTCCGGTCATCGAGGCCCACCATCACCAGTCGCACCACCAGAAGCAGGCGCAGCACCGCCAGCA
        CCACCAGAGCCACCATCGAAAGAAGCACCGTCGACAGCAGCAGCACCATCGTCGACGTGGCCAGAGCACCACGCAATATG
        TGAACCATTCCCCGCCAGGATTCAATCAATCGCAGCAGGCCCAACAGCAGTCAGTGCCTGAAATGGATTTGTTGAAAGCG
        GAAACGTCCAAGGATGAGGAGCCACTGCGTCATCGGGTGGCCCGTGCTGTCACCGCCAAAAAGGAACGCATCTGGGACTA
        TGGGGTGATTCCGTACGAGATCGATGGCAACTTCAGTGGCATCCATAAGGCGCTTTTCAAACTGGCCATGCGCCATTGGG
        AGAACTCCACGTGTATCAAGTTCGTAGAGCGCGACCCGGAGATCCATCCCAATTACATAGTGTTCACGGTTCGCAGCTGC
        GGATGCTGCTCATTTGTGGGCAAACGTGGAAATGGACCGCAGGCCATCTCAATTGGTAGAAATTGCGATAAATTTGGCAT
        TGTGGTCCATGAGTTGGGTCACGTGGTGGGCTTCTGGCACGAGCACACGCGTCCGGATCGGGAAAAGCACGTGGTGATCG
        AGCATAACAACATTATGAAGGGCCAGGACTATAACTTCAATATGCTATCCCCCGATGAAGTGGACTCGCTGGGCATGGCC
        TACGACTATGATTCGATTATGCACTACGCACGGAACACCTTCTCCAAGGGCACCTACCTGGACACCATCCTGCCCATCGA
        GATGAAGGGTCGCAAGCGTCCTGAAATAGGCCAGCGGTTGCGCCTCAGCCAGGGTGACATTGCGCAGGCGAATCTTCTGT
        ACAAGTGTCCAAAGTGCGGAAGAACCTTTCAGGAGAGTTCCGGCATCTTTGCCTCACCATCTCATTACACGGCCGGAGCT
        TTGAGCAATGAGACGGAGCACTGCGAGTGGCGGATTACAGCGACATACGGAGAAAGAGTGGAACTGAAACTGGAGAATAT
        GAACATCTTTAAGTCAAACAACTGCGAGACGGACTACCTAGAGATTCGGGATGGCTACTTCGAGAAGTCACCGCTTATCG
        GACGCTTCTGCGGCAAGGTGGACAAGGAGGTGATCCGCACGGAGTCCAGTCGCATGCTGCTCACCTATGTGAATACACAC
        CGCATCGAGGGCTTCAGGGGCTTCAAGGCGGAGTTCGATGTTGTTTGCGGTGGCGAGTTGTCCGTGGACGATGCCGTTGG
        CCGTTTGGAGTCGCCCAACTATCCACTGGACTATTTGCCCAACAAGGAATGTGTGTGGAAAATAACTGTGCCCGAAAGCT
        ACCAGGTGGCGTTGAAATTCCAGTCCTTCGAAGTGGAGAACCACGACAGCTGTGTCTACGACTACGTCGAGGTCCGGGAC
        GGTCCTGGCCAGGATGCGCCGCTAATTGGCGTTTTCTGTGGCTACAAGCCGCCGCCGAACATGAAGTCAAGTGGCAATTC
        GATGTACGTGAAATTCGTGTCGGACACATCGGTGCAGAAGGCGGGCTTCTCGGCCGTGTTCATGAAGGAGGTGGACGAGT
        GCGAGACCCAGAACCACGGCTGCGAGCACGAATGCATCAACACCCTCGGTGGCTACGAGTGCAGCTGCCGCATCGGATTC
        GAGCTCCACAGCGACAAGAAGCACTGCGAAGATGCCTGTGGCGGTGTCATCGAGTATCCGAATGGCACCATTACCTCGCC
        CTCGTTCCCCGAGATGTACCCTCTGCTGAAGGAGTGCATCTGGGAGATTGTGGCGCCACCGAAGCACAGGATATCGCTAA
        ACTTCACCCACTTCGACCTTGAGGGCACGGCGCATCAGCAATCGGACTGTGGCTACGATTCGGTCACAGTCTACTCAAAA
        CTGGGCGAGAATCGTCTGAAGAGGATCGGCACCTTCTGCGGCTCCAGCATTCCGCCTACGGCCACCTCCGAGAGTAATGC
        GTTGAGACTGGAGTTCCATTCGGACAAGTCCATTCAGAGATCAGGCTTCGCGGCCGTCTTCTTCACGGACATCGACGAGT
        GTGCCGTGAATAATGGTGGTTGTCAGCATGAGTGCCGGAACACGATTGGATCCTACATCTGCATGTGCCACAACGGGTAC
        TCCATGCACGAGAATGGCCACGACTGCAAGGAGGGCGAGTGCAAGTACGAGATCTCCGCCCCCTTCGGCACGATTTTCAG
        TCCCAATTACCCGGATTCCTATCCCCCAAATGCGGACTGCGTTTGGCACTTCATAACCACGCCGGGGCACCGCATCAAGC
        TGATTTTCAACGAGTTCGACGTGGAATCGCATCAGGAATGCACCTACGACAACGTGGCAGTTTACGATGGCGAATCTGAG
        TCCAGTTCGGTCCTGGGTCGCTTCTGCGGGGATAAGATTCCCTTCCCCATCTCCTCCACCAGCAACCAGATGTACATGGT
        GCTCAAGACGGACAAGAACAAGCAAAAGAACGGCTTCACAGCCTCCCACTCCACGGCCTGTGGGGGCTACTTGCGTGCCA
        CTAGCCAGGTGCAGCAGTTCTATTCGCACGCCCGATTCGGAAACCAGGACTATGACGACGGCATGGACTGCGAGTGGACC
        ATCGCGGCGCCGGACAACAGCTACGTCCAGCTCATATTCCTCACCTTCGACATCGAGAGCAGCGAGAACTGCACCTTTGA
        CTACGTGCAGGTGTTCTCTGACATAGACGATGTGTACGGACAGTATGGACCCATGTACGGACAGTACTGTGGCAATGTGC
        TGCCGCAGGACATCAACTCTATGACACATTCTCTGCTGGTTCGCTTTAAGACCGACGGTTCGGTGCCGATGAAGGGCTTC
        TCTGCCTCATATGTGGCCGTGCCCAATTCCGGGGAGTATGACCACTCCGACGAGGATGTGGAGAACTCGTACAGCTCCGA
        GATGGTTACCCCGTTTCCGGGCTCACTGAAGAGCATCTACATCGAGGACACGCAGGAGGAGACCGACGAGTACAGCGACT
        TCAGCGGCAATCAACTGGTCTTCAATGGGCAGTATCGTGGCCGATATAGTCTGCCCAAACGGTACTACTCCGGAAAGGCA
        TAGGGCTATGGTGGAACCACTGACCGTGCGCCAAAATACATGACAATATATTAAAACGGAATTTATTTAACAGATTTAGG
        CATATCGTCGCGTACATAAAACAGACTTTCCCGATCTTCCACGCGCACTCTTCTGGCCAAATCCAGGATATAATCAAAGA
        TCCAATACTAGTTTTAGGCACTCGAAACACACATTGTTAGGTTCCAGTCGGCTAAGATCTGCGGTGGCAATTACTTAGAC
        CCCTATGTCATACATGTAATGTACTTTGACTAGACTTCTCTAGACTCTGTAGCTAAATGTGCAATTCCTCTTCCCCCCTT
        GCATTTGACTGCTTTTTTCTCTGACGCATTTTCATTTTTTTCGGATATCTATATTCTATATTGTGCCATATTTAATGGTA
        ATGATGGAGTGCATTTCCTTAGGCATCTTAGCATAAGTCAATGGGTGGCCCATATCAAAATCAGAACGGAAGTTAGGATA
        GAAAAGAGATACACACATATCTTCGGAAGCACCGAAAGTGGAGGATCCTTACAGATGGATTGAATTTTTCACACAGGCAT
        ATGTACAACTCTCGGATATTTGACTCAACTTAATACGTAATTATATCTATACATATTAAAACTTGCATAGTAACTATGTT
        TTAAAACC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0084689
        5247
        FBtr0339252
        5364
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0084069
        1464
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0084068
        1464
        FBpp0308359
        1464
        Comments

        Only one EST supports this alternative transcript

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        Secondary FlyBase IDs
          References (2)