Open Close
General Information
Symbol
Dmel\Nmnat-RB
Species
D. melanogaster
Annotation Symbol
CG13645-RB
FlyBase ID
FBtr0084750
Feature type
Associated gene
Evidence Rank
Length (nt)
1236
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 16 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AAATAACAACAAGCCGAACAGATGATTGTGAAAATCAGCTGGCCCAAGAACAACATAACAAGCGAATGCTTCCGGCGGTT
        TGGATCTTTTAAAAGACGCTCAAAATCGAAGAAAATGTCAGCATTCATCGAGGAAACAAAAAGCCTGCTGCCGCGGATCG
        CCTTCATAGCCTGCGGATGCTTCAGTCCACCCACACCCATGCACCTTCGGATGTTCGAGATAGCCAAGGACCACTTCGAA
        ATGCAGGGAACCCACAGAGTGGTAGGTGGCATCATCTCGCCCACGCACGACTCATATGGCAAAAAGGGTCTGGCCTCCGC
        CTTGGACAGATGTGCCATGGTCAAGCTGGCCACCCAGAGCTCCAATTGGATTCGGTTGTCCGATTGGGAGGTGCACCAGA
        ATCAGTGGATGCGCACGCAGGCGGTGCTCCAGCACCACCAGAACTATATCAATAACCACATAAATTCCGGCGGGGGAGGC
        GGAGATGACGGGGAGAACACACATCTACCCGGATGGCTGCCTCGTGGGTTGCACGACAGTCGGGATCCTGTACATCTGAA
        GCTACTGTGCGGTGCCGATCTGCTGGAGTCCTTTGCTGTTCCAGGCCTATGGGCAGAGGCCGATATTGAGGACATTGTGG
        CTAACCATGGTTTGGTAGTTATCACCCGGGCCGGCTCAAACCCAGGAAAATTCATCTTTGACTCCGACATATTGACCAAG
        TATCAGAGCAACATTACGCTAATCACCAACTGGGTGCCTAATGAGGTGAGCTCCACGTTGATTCGGCGGCTCTTAGGACG
        CGGCCAGTCGGTCAAGTACCTTCTAGACGATCTGGTGCTGGAGTACATCAAGCGCCAACGATTGTTTAACTTTAAATCGC
        GGGATGCACCGGCTCCGACCGAATGCGACTCTTGACGCGCTTTGCACGTGAAAAAGAAGCCCTCGTCGCCCACACGCTTT
        CCAACCCACCAGCACCGCAAATCGCACCACTTGCCCCACCAGCACCATAAGCTGTTTGAGCCGTGGCGCCTCTTCATGGA
        GCGTGAGTGAGCAGAGCAGATCCGAGTTCAAGTTCCTATTTAGCAGTGATTCCTTTAATGCATGTTTATTTTTGCCCAAT
        CTTAGCCCTTGTAAATACCCTTGTTAAATTAGCCATAGTTTTGCGGTGGTCAGTGTGCGTATCATCTACTTACACCGAAT
        TGTTGCCAAAATGTAGTCCCATTAAACAATAACCTT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0084749
        1287
        FBtr0337012
        1251
        FBtr0473366
        1200
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0084125
        297
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0084124
        389
        FBpp0307941
        358
        FBpp0422970
        266
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG13645-RB
        Nmnat-RB
        Secondary FlyBase IDs
          References (2)