Open Close
General Information
Symbol
Dmel\Lerp-RB
Species
D. melanogaster
Annotation Symbol
CG31072-RB
FlyBase ID
FBtr0085097
Feature type
Associated gene
Evidence Rank
Length (nt)
3457
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 11 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ACTCGCTTGTAAACGTAAAGTAACATTGGTAAGAGCGGGTGTTGTTTTTTGGCCAGAGCCTGCAGGTGACAAAATGCGTT
        GCAGTTTGCAAAAGGACTGCGCAGCTCCCACGCAGGAAAATTTTCGTCAGCAGATGCGTTTCCCAATTGTGATTTCCCTG
        CTTTTGCTGCTTTTCTGCAGCGGTGAGAGTGTCGCCGCTGACGCAGCCAATCAGCTGAAATTTTCCACCACGGAATGTAA
        ACTCAAGGAGCCCATTTACGGCAGCACCTTCGACTTCAGTGGTCTCCACTCGGATTTGGCCCATGTGGTGAAGAGCATGA
        ACATTGGAGGCGACCAATTCGAGTTCAATATATGCGGAAATCTTTCAAGAACCTGCAATGGGGAAAGTAATGTGGCAGCT
        TGTCTCAAAAGACAGGGAAAGGAGTATATTTTGGGTCGTCAGCACGAGTTGTTCTACAACAATGGAAATATGTTTCTGAA
        GTACAAAAGCGGCGCAAAATGCGACAATGGCACTGCCGACAAGCCCAACTACCAGCTGCATGTAATGTTCTCCTGCGACT
        ATACTTTGGATGCCCAGCCTATGCACGTAACGCCTTACGCCAACGAAGTGTGTTCTTTTTACATCTCATATAGGACGCCT
        TTGGCATGCCTATCCATTCCCGAGGGTCTACAATCCAATAGTTGCAGAGTGGGCGACACAAAGTCAAATGGAACCTTCGA
        TCTGATGCCGCTGAGTGATAGTAACTATCATACGAGCAATCGTCAAGGCGCCTTCTTTGTGATCAATGTCTGTAAGCCGG
        TGCTTTATGGAGAGAACAGCATGTGTCCGGCAGGCAGTAGCGTTTGTCTATTTGATAGTAAAGCCACAAATCCAAAAGAA
        CGATTTATCAATTTCGGCAATGTACAAACGCATCCGGTGGTGGAGAAAGGGCAGCTACTGCTCAGGCATGAGTCACCAAC
        GCCATGTGCCAAGAACTCCAGTGCAAACTACACCAGCGTGATTTACTTTAGCTGTGACAAGTTCATAAGGAATGCCCATC
        CGGAGTTCGCGGGTCTGGGAGCCGATTCCTGCACCTATCAGTTCAACTTTGCAACGCCTTTGGCCTGTAATGATCTCAAA
        CCGTGCACGGCCTTTACCTCGACAAATGAGCTGTTGGATCTGAGTTCGCTTAGCTCTAAGCCAGCTCGCACTTTGCTTAA
        GGATGGCAAGAACTATACAATTGCTGTGTGCGCACATGCTGGGGCGCCCTGCCAGGAAAATGGCGGCGCTTGTTACGAGC
        AGAATTCCACGACCATCAGCCTGGGCAACTCCAACTCGCAGCTGCGTTTCAATCAGACCGGTTCGCTGTATTTGCTGTAC
        GAGGATGGTGCCGAGTGCTCCACAGCAACGGGCATGCGGCGCTGGTCGACAAAAATCGAGTTTGTCTGTGCGAACAATGC
        GACGAAGGACAATGGAGCCAGCACTGCTGGCGGTAGCGATTCTTTGAAAATAATTGAGGACTCCAATTGTCAGCTGTTGA
        TCCAATATCAGACGCCGCTTGCCTGCCGGGAGCCGATTAGATGCAAGGCAACCACCTATGTGGACCACACAAACGATGGA
        CTGGGCAGCAGCGGCGACGAGCTGATCGACCTAACGCCATTGATTAGCGCCACCGACAACTACGAGGCAAGAGTGGAGCT
        GCCGGCCAGCATGGAGCACCTGGTGCCCAAGACGACCAAGTTCTTTTTGAATGTGTGCCGTCCATTAGTGCCCAAATACC
        AATTAGGCTGTGCCGGCGGATCTGCTGCCTGCATGGCCAAAGTGACTGCCGCCGGCGCCCCCGAGGAGGAGCGTAGCATG
        GGCTTTCCTCTGGTGTCACTGACGCAACGGAATCGCACCTTCGCCGAGCTGGCTTACTTGAAGGGAGACCCCTGTCCCAC
        AGACAACACCTCGGAGCTCTCAACGCACATCCTTTTCAACTGTAATATGCGTGCCGGTCGGGGACAGCCCGTGCTACGTT
        CGGTTGAGGACTGTGCCTATCGGTTCGAGTGGGAGACCAATGTCTTCTGTCCGCCGCACGAGTGCACCTTCAGTGCGGAC
        ACCTGCGATCTGGTGCACGACGAGCTGGGTCGTCGTTTCAACTTCAAGAGTGCGCCGTTCACCAAGGATGGCAAGATTGA
        GATTGACTACAACGCCACGAAGATGTCGGTAAACATTTGCGGAGCGCATCGCAAGGCAATGACGGACTATTCGCAGGCGC
        TGGTCAACATATTCTTCACACACGAGTCGCCTAATTGCGGTCGGGAAGGCACAATGAACGTCCAGATCCGGCTGATATGC
        AGCGACCAGACCGAGAGCAGCAGTACCATCTCGAGCGACCAGCAATGCAATTTGCTTTATGTGCAACGAACGCCGAGCAT
        CTGCGAGTTCCTTTCCCTCGGCGCAACGCAGCAGAATTTTGAAAGCAATGGCTCCACGAGCAGTAGCACCAGCAGCAGCA
        GCACATCCACCACCACCAGCACGACTACCCAGGCATCGCCAGCGGCCATCCTGGGGGCCATTCTCTCGGTGACCTTCTGC
        GTGACGTGCCTGGGCCTGTTGGCCTTTTCGCCGGCACGAAGGCAGCGCATCCGCCGCCTCTTCCGGCGCAGCAACTCCGC
        GGTGCGATACTCCCGGGTGCAATCCAATGAGGAGGCCAACCTGCTATTGGAACCCAATGGGGAGTTCACCGAAAGCGATG
        ACGACATGCTGCTTTAGGTGGGCCCAATCTAAGCCAAGTCGTCGTGGGACGCCTTCTTTGCCATTAGGATGATGAGGCTG
        ATGGGGGACAGATGGTGGTGGGAAGGAGCGGGGGTAGCTAGTTAAAGTCGCGAGAGATCCCAATGTGAGTAACATAGGAC
        ACCAAAGAAGACATTACTGAAAACTGGAACTGATTGTGAGCTAAACAAACCAATTGAAAACTAAAGAAAACCGTAGTAGA
        CAAGTAGCGATAAGAGGGGGGCGAACTGCTGATATAAACTGTACAATACGCGTAGGCTACAACGACGACTTACGAAAACC
        AATTACCGGAACCATACATATATACACATTATATATTTTATATACCCTTCGTATGTAAAGGAGAATCCCCAACCTAACCC
        GTACCTATAGCTATAGTTAAATGCGGCCTGCATTCGCCAGAGAATTGCAAAGGACAATTGCTTAAATCGTATTTTCGCTG
        ACGCCAAAATGTATAACCAGTATAGCGCAGCAGCTTTTTCCTTCCATAAAAGATGTGATTTCATTTTTAAAACTTTCAAG
        TGCAGCTTGTTAGTGGTATTCCTTTGAAACGATTTGTATTTTACTCTAAGGCAATCTGTACTTACATTTATGTTTGTGTC
        TTGAGTTGTTTTTAGTTCAATAAGGCGAGCCACACTTAAAACGGCTGAGTGTACAATTTTAAGTGTATACATAATAAAAT
        CTAAAACAATATATACG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0085099
        3478
        FBtr0300939
        3571
        FBtr0334310
        3535
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0084467
        887
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0099603
        886
        FBpp0290161
        917
        FBpp0306425
        918
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (3)
        Reported As
        Symbol Synonym
        CG31072-RB
        CG6390-RB
        Secondary FlyBase IDs
          References (2)