Open Close
General Information
Symbol
Dmel\Lerp-RA
Species
D. melanogaster
Annotation Symbol
CG31072-RA
FlyBase ID
FBtr0085099
Feature type
Associated gene
Evidence Rank
Length (nt)
3478
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 12 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ACTCGCTTGTAAACGTAAAGTAACATTGGTAAGAGCGGGTGTTGTTTTTTGGCCAGGTAATTTAGCCGCATCCGAAAAAG
      AGCCTGCAGGTGACAAAATGCGTTGCAGTTTGCAAAAGGACTGCGCAGCTCCCACGCAGGAAAATTTTCGTCAGATGCGT
      TTCCCAATTGTGATTTCCCTGCTTTTGCTGCTTTTCTGCAGCGGTGAGAGTGTCGCCGCTGACGCAGCCAATCAGCTGAA
      ATTTTCCACCACGGAATGTAAACTCAAGGAGCCCATTTACGGCAGCACCTTCGACTTCAGTGGTCTCCACTCGGATTTGG
      CCCATGTGGTGAAGAGCATGAACATTGGAGGCGACCAATTCGAGTTCAATATATGCGGAAATCTTTCAAGAACCTGCAAT
      GGGGAAAGTAATGTGGCAGCTTGTCTCAAAAGACAGGGAAAGGAGTATATTTTGGGTCGTCAGCACGAGTTGTTCTACAA
      CAATGGAAATATGTTTCTGAAGTACAAAAGCGGCGCAAAATGCGACAATGGCACTGCCGACAAGCCCAACTACCAGCTGC
      ATGTAATGTTCTCCTGCGACTATACTTTGGATGCCCAGCCTATGCACGTAACGCCTTACGCCAACGAAGTGTGTTCTTTT
      TACATCTCATATAGGACGCCTTTGGCATGCCTATCCATTCCCGAGGGTCTACAATCCAATAGTTGCAGAGTGGGCGACAC
      AAAGTCAAATGGAACCTTCGATCTGATGCCGCTGAGTGATAGTAACTATCATACGAGCAATCGTCAAGGCGCCTTCTTTG
      TGATCAATGTCTGTAAGCCGGTGCTTTATGGAGAGAACAGCATGTGTCCGGCAGGCAGTAGCGTTTGTCTATTTGATAGT
      AAAGCCACAAATCCAAAAGAACGATTTATCAATTTCGGCAATGTACAAACGCATCCGGTGGTGGAGAAAGGGCAGCTACT
      GCTCAGGCATGAGTCACCAACGCCATGTGCCAAGAACTCCAGTGCAAACTACACCAGCGTGATTTACTTTAGCTGTGACA
      AGTTCATAAGGAATGCCCATCCGGAGTTCGCGGGTCTGGGAGCCGATTCCTGCACCTATCAGTTCAACTTTGCAACGCCT
      TTGGCCTGTAATGATCTCAAACCGTGCACGGCCTTTACCTCGACAAATGAGCTGTTGGATCTGAGTTCGCTTAGCTCTAA
      GCCAGCTCGCACTTTGCTTAAGGATGGCAAGAACTATACAATTGCTGTGTGCGCACATGCTGGGGCGCCCTGCCAGGAAA
      ATGGCGGCGCTTGTTACGAGCAGAATTCCACGACCATCAGCCTGGGCAACTCCAACTCGCAGCTGCGTTTCAATCAGACC
      GGTTCGCTGTATTTGCTGTACGAGGATGGTGCCGAGTGCTCCACAGCAACGGGCATGCGGCGCTGGTCGACAAAAATCGA
      GTTTGTCTGTGCGAACAATGCGACGAAGGACAATGGAGCCAGCACTGCTGGCGGTAGCGATTCTTTGAAAATAATTGAGG
      ACTCCAATTGTCAGCTGTTGATCCAATATCAGACGCCGCTTGCCTGCCGGGAGCCGATTAGATGCAAGGCAACCACCTAT
      GTGGACCACACAAACGATGGACTGGGCAGCAGCGGCGACGAGCTGATCGACCTAACGCCATTGATTAGCGCCACCGACAA
      CTACGAGGCAAGAGTGGAGCTGCCGGCCAGCATGGAGCACCTGGTGCCCAAGACGACCAAGTTCTTTTTGAATGTGTGCC
      GTCCATTAGTGCCCAAATACCAATTAGGCTGTGCCGGCGGATCTGCTGCCTGCATGGCCAAAGTGACTGCCGCCGGCGCC
      CCCGAGGAGGAGCGTAGCATGGGCTTTCCTCTGGTGTCACTGACGCAACGGAATCGCACCTTCGCCGAGCTGGCTTACTT
      GAAGGGAGACCCCTGTCCCACAGACAACACCTCGGAGCTCTCAACGCACATCCTTTTCAACTGTAATATGCGTGCCGGTC
      GGGGACAGCCCGTGCTACGTTCGGTTGAGGACTGTGCCTATCGGTTCGAGTGGGAGACCAATGTCTTCTGTCCGCCGCAC
      GAGTGCACCTTCAGTGCGGACACCTGCGATCTGGTGCACGACGAGCTGGGTCGTCGTTTCAACTTCAAGAGTGCGCCGTT
      CACCAAGGATGGCAAGATTGAGATTGACTACAACGCCACGAAGATGTCGGTAAACATTTGCGGAGCGCATCGCAAGGCAA
      TGACGGACTATTCGCAGGCGCTGGTCAACATATTCTTCACACACGAGTCGCCTAATTGCGGTCGGGAAGGCACAATGAAC
      GTCCAGATCCGGCTGATATGCAGCGACCAGACCGAGAGCAGCAGTACCATCTCGAGCGACCAGCAATGCAATTTGCTTTA
      TGTGCAACGAACGCCGAGCATCTGCGAGTTCCTTTCCCTCGGCGCAACGCAGCAGAATTTTGAAAGCAATGGCTCCACGA
      GCAGTAGCACCAGCAGCAGCAGCACATCCACCACCACCAGCACGACTACCCAGGCATCGCCAGCGGCCATCCTGGGGGCC
      ATTCTCTCGGTGACCTTCTGCGTGACGTGCCTGGGCCTGTTGGCCTTTTCGCCGGCACGAAGGCAGCGCATCCGCCGCCT
      CTTCCGGCGCAGCAACTCCGCGGTGCGATACTCCCGGGTGCAATCCAATGAGGAGGCCAACCTGCTATTGGAACCCAATG
      GGGAGTTCACCGAAAGCGATGACGACATGCTGCTTTAGGTGGGCCCAATCTAAGCCAAGTCGTCGTGGGACGCCTTCTTT
      GCCATTAGGATGATGAGGCTGATGGGGGACAGATGGTGGTGGGAAGGAGCGGGGGTAGCTAGTTAAAGTCGCGAGAGATC
      CCAATGTGAGTAACATAGGACACCAAAGAAGACATTACTGAAAACTGGAACTGATTGTGAGCTAAACAAACCAATTGAAA
      ACTAAAGAAAACCGTAGTAGACAAGTAGCGATAAGAGGGGGGCGAACTGCTGATATAAACTGTACAATACGCGTAGGCTA
      CAACGACGACTTACGAAAACCAATTACCGGAACCATACATATATACACATTATATATTTTATATACCCTTCGTATGTAAA
      GGAGAATCCCCAACCTAACCCGTACCTATAGCTATAGTTAAATGCGGCCTGCATTCGCCAGAGAATTGCAAAGGACAATT
      GCTTAAATCGTATTTTCGCTGACGCCAAAATGTATAACCAGTATAGCGCAGCAGCTTTTTCCTTCCATAAAAGATGTGAT
      TTCATTTTTAAAACTTTCAAGTGCAGCTTGTTAGTGGTATTCCTTTGAAACGATTTGTATTTTACTCTAAGGCAATCTGT
      ACTTACATTTATGTTTGTGTCTTGAGTTGTTTTTAGTTCAATAAGGCGAGCCACACTTAAAACGGCTGAGTGTACAATTT
      TAAGTGTATACATAATAAAATCTAAAACAATATATACG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0085097
      3457
      FBtr0300939
      3571
      FBtr0334310
      3535
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0099603
      886
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0084467
      887
      FBpp0290161
      917
      FBpp0306425
      918
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG31072-RA
      Secondary FlyBase IDs
        References (2)