Open Close
General Information
Symbol
Dmel\wdb-RD
Species
D. melanogaster
Annotation Symbol
CG5643-RD
FlyBase ID
FBtr0085204
Feature type
Associated gene
Evidence Rank
Length (nt)
6842
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 45 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GCGCTTTGCAACACTAATCGCTTCAAAGATGGCGTCACTTCTACGGTGTCTGTGTGAACGATTCTAGTTGCCGCTGGAGA
          AAATTCGTAATTCTCGCATAAAGCGCACCTGCCGGTTACCAAAATCGATTGAAAAGCGAACGTCCCATATTGCGGCGCGA
          TAAGCGGGTGAAATTGTGGCAGTGCGTGCGCGATAGACTGTTAGAAAAGCAGTGCAAATTGGAAGTCCGGATGCTCGAAG
          TGAAAACCAGCAAGCAGCGCTAAACCGCCAGCCAAAAGCAAAGATAAAACGAGAAAAAGCATCTCCGTGACGTAGGCAAA
          CGCGAGAGCCGAAACCGAAAACCAAAACTGAAACTGAAAAAACTGAGATATCGAGCAGACGAGAATTACAAACTCTGAAA
          TCGAGAAAGTGCATGTGATGCCAAATATCCATAAAACGCAACAAGGAAATCGGCAAATGTGAATTACTATGTGAATGCAG
          CAATCGGCAATCAGCAGTTAGCCAGCAGCAGCAGCTCTCCCTCAGTTAACCAAATTGATGTGCCATTCAGGAGCAGCAGC
          GCAGAAAGAAGAGGATCAGGATCAGGATCACATCAGATCAGATCGGAGCAACGTAGAAGCTAAGCGAGAGTATTAACCAG
          AGTGTAAGGCGCATCGCATATGCAACAATCCCTCCAGTAAACAATACAGAAAGCAAAGTATAGCAAACACAAAAAGAAAC
          AGTGTACATACAACTGTAACGAATTTAAGCAAGAAGCAAGCGGCTAAAGAAGAGTATAGACCCAATTCACGCCCCCGAGT
          AACCGTCTGATAAATGCCAAGATAAGTCGTTACCGCTTTAATACCGCCATCAACATTACCCAGCAACAAAAGCTGATCCA
          GCAGCTCCAGCAGCAGCAACAGCAGCAGGCGATCGCTTTCAGGGAGAAGAAACAGAAACAGAAGCTGAAATTGCAATTGC
          AGCAGCCGTTGCAGTTGCAGATTGGTCAGGACGCGAACGGGATAGGCGGAGGAGGAGAGGAGGGAGTAGAGCTGTTGGGC
          TTACCCAAAGGTACCGAGAACAATTGCAAGACGCCAAACTCAACCGCAAAAGTCGCCAACATAACACATAAAATTTTCGG
          TTGGCTACGCAAGACACGCAACAAACGACCAGTCGAGATCCTCAACAGCGATTTCGGCGAAGACGGCGACGAGGGCGTTG
          GCGAGGGCAAAGGCCAAGGCGCAGGCGAGGGAGGAGGAGCAGCTGCCAGTGCAGCTGGCGGTGCAGCCGATCAATTTCCA
          GTGGCAAGCGTTAAAAACAAAGCCGGCAAGCTGAATACCACACAGACAGCCACGGAGACCGCCATCGATTCAAACGAACC
          CAAATCTGAAAAGATGTCATCGGGCACGTTTGTGGATCGAATCGACCCGTTCGCCAAACGTTCGCTCAAGAAGAAGGGTA
          AAAAGAGTCAAGGTTCCTCGCGCTACAGAAATTCTCAGGATGTTGAGCTGCAGCAATTGCCGCCGCTGAAAGCTGATTGC
          TCCAGCCTAGAACAGGAGGAGCTGTTCATAAGGAAGCTGCGCCAGTGTTGCGTGTCCTTTGACTTTATGGATCCCGTGAC
          GGACTTGAAGGGCAAGGAGATCAAACGGGCCGCGCTCAATGACCTATCCACCTATATAACACATGGGCGCGGCGTGCTTA
          CGGAACCGGTTTATCCGGAAATAATTCGTATGATTTCTTGCAACCTATTTCGCACGTTGCCGCCCAGTGAGAACCCTGAT
          TTCGATCCCGAGGAGGACGATCCGACACTGGAGGCGTCCTGGCCACACCTCCAACTGGTGTACGAGGTCTTCTTGCGGTT
          TCTGGAGTCGCAGGATTTCCAAGCAACTATCGGCAAGCGTGTGATCGATCAAAAGTTTGTCTTGCAGCTTTTGGAACTTT
          TCGACTCGGAGGATCCCAGGGAGCGGGACTTTCTGAAGACGGTATTGCATCGTATATATGGAAAATTCTTAGGACTGCGG
          GCTTTTATACGAAAACAGATTAACAACATATTCTTGCGATTCATTTACGAAACGGAGCACTTTAATGGAGTCGGTGAGCT
          CTTGGAAATCCTTGGCAGTATCATCAACGGATTCGCCTTGCCCCTGAAGGCCGAACACAAACAGTTTCTGGTTAAGGTCC
          TATTGCCACTGCACAAAGTCAAATGCCTGTCGCTCTACCACGCTCAACTGGCGTATTGCATTGTACAATTCCTAGAGAAG
          GATCCATTCCTTACCGAACCGGTGGTGCGTGGCCTGCTGAAGTTCTGGCCCAAGACGTGTTCCCAGAAGGAGGTCATGTT
          CCTGGGCGAGATTGAGGAGATCCTCGATGTGATCGATCCGCCGCAGTTTGTCAAGATTCAGGAGCCGCTATTCCGTCAGA
          TTGCAAAATGCGTGTCGAGTCCACATTTTCAGGTTGCTGAGCGAGCTCTTTATCTGTGGAACAATGAGTACGCCATGTCG
          CTAATCGAGGAGAACAATGCGGTCATCATGCCGATCATGTTCCCGGCCCTATACCGCATCAGCAAGGAACACTGGAATCA
          AACTATCGTGGCGCTCGTATACAACGTTTTGAAGACGTTCATGGAGATGAATTCGAAACTGTTCGACGAGCTTACCTCCA
          GCTACAAGGCGGAGCGGCAAAAGGAAAAAAAACGTGAGCGTGACCGCGAGGAACTGTGGAAGAAACTGCACGAACTCGAA
          TCCAATCGTTCTAGTGGGCGCACCGCCGGCGGCAGCGCCACGACATCGAACAGCGCAGCTTCCGCGGCGTCAACGTCCCT
          GCAGCCACCCAGCTCCGCTGGCCTGAACTCTCATCAGCAGCAGTCGAATAGCGGCAGCAGCGGTAGCCTGTCCAGCGGCG
          GTGCCGGCGGCGACAATAATCCTGCGACCACAAATGCGAAAATCAAACAGGATAAGGCGGACAACTAAGCAACGCGAGGC
          GCGCCGGAAACTAACAATAAAACCAAGATCAGTAAGAGCGTAAGCGTAACGCGTTATCCGATATCCGTAAACGGCAGAGA
          GACAGCAAGCAAGCAACCACATCTAAAGGAGAAATAAATAGTTATACTAAACCACACATATGCTAAACCTTAAAACCAGA
          AAACATAAAACTGAAACGTATACTCGATTGACAAGACACCAACCAAGCTGGCCAGACCCACAGCTCGCTTGGGCGGCTGT
          TGAAGGAGGTAGAACCGAAATCTGGATCGGGATCAGGATCGGGAGCTGGATCATCAGATCCCAGGGCGTGTGTGTGTCCG
          CGTTAATTAAGAAGCTTGAGTGCGGCATTAAAGAAATCTTTATAAATAATGTATCTTACGACTACAGCAACACACACACA
          CACACCACACACACGTGCGCGACACGTATAAATATATATTACAAAGGAAGAAAATAATTATTAATTACGTTTAAGCGAAA
          AGATGTTGAATAAAGAGAAATCATGTTAGTAAGTGAAAAGCAGCAGAGCGATAACTATAACGGATTGACGATTGTTGAAG
          CGCATTGAATATTATTAACTAAACATATTGCTAACTAGAGATCCTAGAGCATAGATCGATCAGCCATCCTATCCTATTCC
          CCCCCCCCCCCCCTCACCCAACAAAGAAAACCACAGCACCCAAATCACCGAAATGTTCACATGCTAAGTAATCGCGTTCA
          TTTGAAGATTGTAAAATAGTTGAAACTGCGCTGAATCCTCAGACTTTTGTTTTTTTTTTTTTTTTAATTAACAAATTAAC
          GAATTGCTCCATAGAACGGCGTGTCTTATTGCAGACTTCCCACTGAATTGTATATAAATTAATCGAGAATTGTGCTCCCC
          CTCACCCACAATGAAACTTTGTTACTTAGCTTTAAGTGTTGCACACTCCGTCAAGACTTCTCGAAAACAGAAATTCCAAC
          AATACCCGCTAAAGAAAATGCCTGCGCAGTTACCAAGCCGAATCTGTATTCGAACGTAGAGAGACATGAGAAAAACATAA
          GCAAAGCGAAGCCAAGTTTTAGTACATTGTTGAAGTTGCTGCTAAACGGGCCGAGATGGACAGGGAGCCGGCAAATCTAT
          AATTAGTTAAGAACACAATTGAATACCATACTATAACGTACGATAAACGCTGATCTATATAAATGTATGTAAAGTGTAAA
          GCGGCGGATACACAAAACTATATATCTCCCAGCTGAGGAATAGGCGCATGCGCGGAAATCAACATGTACTCGGCAAGAAA
          TGATTACAAATATTGAGAATTGTAAAAAGTTTAAGCTAGAGATACCAATAACCCAGCAAAACGATAGTCTTTAGAACAAG
          GTTATGGAAAATTCAGCTTGGGCATACGTTAATTGGCATCTTGCGATACATTTCCACAGTTCACAGTCCAGGCTCGATAT
          GCATCCACACACATACTAAAAGCTCCTTTCCATAAATGTATATCTCTGCGAAAAGCGGCCCAGTTTCAAGTAACAAATAG
          TTTGCAAATGCCTTTCAGACTCTTCTCGATTGAATTAAGAACTCAACCTATTATTCACTGCTCACGGAAATGCGCACAAT
          TGTCATTCGATTTGCTAAACAATACCTTCGATTGTAAATAATGTAGCTAAGTTAAACAGGGGAAATACTTTTGGGCCGCT
          TTCCCAGCATCTCACACTCACACTTAGCCGCACTCATAGTAAGGAAATATATAAAATTTATATATGAGATATGCTATTCA
          TATGTATGTTTGTTCATTCAACTCTCACGCGCCCATTACAAAGTATAGAAAGAAGCATGCATTATAGGAGCAAAACTATA
          GGGAAGTATCCACTAATGAATGTCTCTCATTAGGCGAAACCGCGAAAGTTCATATAATATTAATGATAATTGTGTCTGTG
          AATCGTGAGTTATTATACACATATATGTATACATATATTGCAAACAAAAACGAAAAATGCAAAAAAAAAACTTAAAAAAA
          ATCTAAAGGAAACGTAAAAGTTAGCGTTATTATTAAATATGTTTGTAAAACGTCAACAATATGCAAAAAATGAAATTAAA
          TGAAATGAAAAGCGAGCGAAAGGCGCATTGAGGGCATCTAACTAAAGATTGGTCGTATATTTCGAAACACAAATTGAACC
          CATGGCCTAAATACTAAGCGACGTGTGTGTAAGAAAGTTTTGCATCTTTATATTAGCGTGTAATTAAACAAATGAAATAG
          CTAAACGAAGCCCAAGCCTAAACAGCAAACTACAACTAGAGCTACTACAAACTACCCACGAGTATCATCCCTCCCTGCCT
          CCCCTCATTAGCCCACAATAGCGATCAGATCGAATCCTATAGCCCCCGAGCGTTAAGTCCTACTGCCTTTCAAAAGATTC
          CAAGAAGAACACCAAATATAATGAAACACGAAGAAATGTTAAAACTCGAACAGGCAGCACTTATCGACTCGACCTGTTTG
          TTATGCCCATCTAGTAACTAACACCAATCTCAGATCCTAACTAGCAGATCCGAAAAACGAATAGGACCCATCTCTAGTTA
          AAGTTGATGTTTGCCTAGGATGCCAATCAGTAAAACAAAAAAGAAGAACATATTCAAATAACGCAAGTGTAAAAACGAAA
          CCAGAAATCAAGTAAGCAACAAGCATTAGATTAAGATTAATGAAAAATGTTGAAAAAGAATGCCTAATAAACGATAAAAA
          GAACATATTGTATAAGTCATAAGTGGTTCAATGATTATTGCCTCTTCATCATCATTTCGTTTGTTTTGTGATCAACACCT
          TTGTTGCACTCTGAGTTAATCTGTTTAGTCCGCATTCAAAGTAAAAAAAAAAAATGGTAACTTTAACTATAGTTTCTATT
          ATTGTATTTATATGTATAAACAAATGGAGCATGTTAATTCGTAACTGCGGAAGCTGCTTAGAGCCAGCTGAGCGAAGAGG
          TTTAAGCAAATGCAAAACTCGTTAAGTACTTTTAGAGAGAAAACCCTGTACTAACTAAGATGTGTACTACAAATAAAGTC
          GCATTAACAACGTTGCATCCGAGATCAGAAGAAACACTCAAAAAAAAAAACAAAAAACACTTAACAAATGAAAATGCCGA
          ACAACGGATCAGCTAGCCAAGGCAGCAACAATAAGAGCTAAATAGTTAAAGCGCTTAAACAATTTAAAAACTATGGATAC
          TAACAATGAAATGCGAACGGATAAATATATATGTAAATCATGTATTTTCTTATGTTCTAGACTTGTAAAAAAAAAAACCT
          ATCGTACACACGCTATATTATTACGTTTTTTAAACTTTGAGTTCTAGTTCTGTGTAGGCCGGTGTGCCAGGATTTCGATT
          CTTTTTTCCTTTGGTTAAAGGCACACAGCACCCACACCACCCACAATCGCACACACACTTACTCACTCACACACACACAC
          ACGACTAAACAAAATCTTATGCTGAGAGTAAATATAAAGAGTAAATTATAATTACACAAACATAAATGGGAATAAATATA
          TATATATATAGGTATATATAAACAGCATATATATATAAAAAAGGAAAATTATATATGGAGAAGCATCGGAAAAAAGAGGT
          TTAGTTGATTGCTTTCGAATCCAGGCAGAAAGTATGCGAAAATAAAGTAAATTAACTAACTAATGGCGAGAAGCAGCAGA
          AAAAAAAATAATTAAAATTGCATGGCGCAGGCAAAAACAAATATTTAGCTGCAAGCAGAATTAACCAAAAATGATTAAAA
          ACCAAGTAAAAGATGAAACAAAAAAAAAACACACAAAAACTGAATGAATGAGAATGATGAGCAAACGGAGAGAAAAGAAG
          CAAAGAGATCAATCAACAATAAAAAATTAATAAATACAAAAT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0085207
          3627
          FBtr0085203
          3306
          FBtr0085208
          6833
          FBtr0085209
          3635
          FBtr0085205
          7086
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0084574
          524
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0084577
          524
          FBpp0084573
          524
          FBpp0084578
          524
          FBpp0084579
          524
          FBpp0084575
          524
          Comments
          Extended 3' UTR based on RNA-Seq and/or EST data.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG5643-RD
          Secondary FlyBase IDs
            References (2)